PCR (polymerase chain reaction) detection method for CGG repeat number of FMR1 (fragile X mental retardation 1) gene 5' terminal noncoding region
A non-coding region and gene technology, applied in the field of PCR detection of the number of CGG repeats in the non-coding region of the 5' end of the FMR1 gene, can solve the problems of mental decline, irritability, personality changes, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
example 1
[0027] Example 1. The method of genomic DNA sodium nitrite treatment
[0028] Reagents and buffers required:
[0029] a) 5 micrograms of genomic DNA.
[0030] b) 1M NaOH solution
[0031] c) 3M sodium acetate solution (pH5.3)
[0032] d) absolute ethanol
[0033] e) Sodium nitrite buffer solution, its composition is sodium nitrite 500mM, sodium acetate 26mM, acetic acid 52mM, sodium chloride 150mM
[0034] experimental method:
[0035] Add an equal volume of 1M NaOH to human genomic DNA. Place in a 70°C water bath for 1 hour and immediately place on ice. Then add an equimolar amount of HCL to neutralize the reaction system. After adding 1 / 10 volume of 3M sodium acetate (pH5.5) to stabilize the pH, then add twice the volume of absolute ethanol. Centrifuge the DNA in a benchtop centrifuge at 12,000 rpm. Dissolve the DNA pellet in 500ul of freshly prepared sodium nitrite buffer. Place in a water bath at 50°C for 16 hours and then add twice the volume of absolute ethano...
example 2
[0036] Example 2. PCR reaction
[0037] Prepare the PCR reaction system according to Beijing Kangwei Century LAmp DNA Polymerase MasterMix instructions, including: 2X LAmp DNA Polymerase MasterMix, genomic DNA 100ng obtained from Example 1, MgCl 2 1.5 mM, upstream primer (SEQ ID NO: 1): TCAGGCGCTCAGCTCCGTTTCGGTTTCA and downstream primer (SEQ ID NO: 2): AAGCGCCATTGGAGCCCCGCACTTCC: 1uM each. Betaine 2M. The thermal cycle program of PCR reaction is: 98°C for 5min; 35 cycles of 98°C for 10s-64°C for 30s-68°C for 2min; 68°C for 4min.
example 3
[0038] Example 3. (CCT) 4 and (CCG) 4 degenerate primer PCR reaction
[0039] Prepare the PCR reaction system according to Beijing Kangwei Century LAmp DNA Polymerase MasterMix instructions, including: 2X LAmp DNA Polymerase MasterMix, genomic DNA 100ng obtained from Example 1, MgCl 2 1.5 mM, upstream primer TCAGGCGCTCAGCTCCGTTTCGGTTTCA (SEQ ID NO: 1), (CCT) 4 Primers CCTCCTCCTCCT (SEQ ID NO: 3) and (CCG) 4 Primers CCGCCGCCGCCG (SEQ ID NO: 4) were 1 uM each. Betaine 2M. The thermal cycle program of PCR reaction is: 98°C for 5min; 35 cycles of 98°C for 10s-64°C for 30s-68°C for 2min; 68°C for 4min.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More