Antibacterial peptide NX-16, and preparation method and application thereof

A technology of NX-16 and antimicrobial peptides, applied in chemical instruments and methods, peptides, bacteria, etc., can solve problems such as unsatisfactory results and affecting the expression of antimicrobial peptides, and achieve easy operation, high antibacterial activity, and good stability Effect

Inactive Publication Date: 2013-05-29
HENAN INST OF SCI & TECH
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It has been reported that antibacterial peptides were expressed in the form of fusion proteins using the E. coli expression system, but the results were not very satisfactory
At the same time, some researchers have raised the question that the antimicrobial peptides expressed by E. coli have a certain killing effect on E. coli itself, which will affect the expression of antimicrobial peptides.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antibacterial peptide NX-16, and preparation method and application thereof
  • Antibacterial peptide NX-16, and preparation method and application thereof
  • Antibacterial peptide NX-16, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1: Amino acid and gene design of antimicrobial peptide

[0034] (1) The artificially designed antimicrobial peptide NX-16, whose amino acid sequence is ILPWHYPFFPWRRPFR, and PFR is the Kallikrein cleavage site, was artificially synthesized for the entire sequence, and the synthetic peptide was proved to have antibacterial activity by the agarose plate diffusion method, see Example 6.

[0035] (2) Concatenate the new antimicrobial peptide sequence designed in (1) by 3 repeats, design the tandem gene of the tandem amino acid sequence according to the codon preference of Escherichia coli, and add nucleic acid restriction endonucleases at both ends ( xho I and Nco I) Recognition sites and protective bases form the target gene to be expressed.

[0036] The designed tandem target gene sequence is: 5'-G GAATTC A CCATGG ATCCATTTCGTAT TCTGCCGTGGCATTACCCGTTCTTCCCGTGGAGAAGACCATTTCGTATTCTGCCGTGGCATTACCCGTTCTTCCCGTGGAGAAGACCATTTCGTATTCTGCCGTGGCATTACCCGTTCTTCCCG...

Embodiment 2

[0037] Example 2: Primer design and amplification of the target gene

[0038] (1) Using SOEingPCR to design primers, design the target gene described in Example 1 into four complementary overlapping fragments, which contain twelve overlapping base fragments. The overlapping fragments are: G1 contains 57 bases, G2 contains 56 bases, G3 contains 55 bases, and G4 contains 54 bases. Wherein G1 and G2 contain 12 overlapping bases, G2 and G3 contain 17 overlapping bases, and G3 and G4 contain 15 overlapping bases. The base sequences of the four overlapping fragments are:

[0039] G1:G GAATTC A CCATGG ATCCATTTCGTATTCTGCCGTGGCATTACCCGTTCTTCCCGTG

[0040] G2: GGAAGAACGGGTAATGCCACGGCAGAATACGAAATGGTCTTCTCCACGGGAAGAAC

[0041] G3: GCATTACCCGTTCTTCCCGTGGAGAAGACCATTTCGTATTCTGCCGTGGCATTAC

[0042] G4: CCG CTCGAG ACGAAATGGTCTTTCTCCACGGGAAGAACGGGATATGCCACGGCAG

[0043] (2) The two overlapping fragments serve as templates and primers for TD-PCR amplification.

[0044] Use the ov...

Embodiment 3

[0048] Embodiment 3: Construction and identification of expression vector

[0049] For the construction method of expression vector, see figure 1 .

[0050] (1) Extract the plasmid pET30a(+) with a conventional plasmid extraction kit, and then perform double digestion. Enzyme digestion system (50μl): plasmid 30μl, 10×Buffer 10μl, xho I 3 μl, Nco 1 μl of I, 6 μl of deionized water, digested at 37°C for 2 hours, and analyzed by 1% agarose gel electrophoresis.

[0051] (2) Double digestion of the target gene. Enzyme digestion system (50 μl): 30 μl of the target gene obtained in Example 2, 10 μl of 10×Buffer, xho I 3 μl, Nco I 1 μl, deionized water 6 μl. Analyzed by 1% agarose gel electrophoresis after digestion at 37°C for 45 min.

[0052] (3) Connection of target gene and vector. Reaction system (10μl): 4ml of recovered DNA fragments, 1ml of vector recovered after digestion, 0.5ml of T4 DNA ligase (350U / μl), 1ml of ligase buffer, 3.5ml of deionized water, in a c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an antibacterial peptide NX-16, and a preparation method and application thereof. The preparation method comprises the steps as follows: the amino acid sequence of the antibacterial peptide NX-16 is designed; the prokaryotic expression tandem gene of the antibacterial peptide NX-16 is designed according to the preference of Escherichia coli codon; a target gene is synthesized by a splicing by overlap extension PCR (polymerase chain reaction) method; an expression vector is built by an enzyme-linked method, the expression vector is transformed in Escherichia coli for expression, and the expression product is subjected to enzymolysis, thus obtaining the antibacterial peptide NX-16. In the preparation method provided by the invention, the gene of the antibacterial peptide is modified and is then subjected to efficient tandem expression in Escherichia coli (the expression product is a polymerized peptide of multiple molecules of the antibacterial peptide, does nothave antibacterial activity and does not have killing or inhibiting effects on Escherichia coli), and then the antibacterial peptide molecule with antibacterial activity is obtained by an enzymolysismethod; the obtained antibacterial peptide has broad application prospects in the pharmaceutical industry and animal husbandry; and the preparation method provided by the invention has the advantagesof high expression efficiency, simple separation and purification, easy operation and good stability.

Description

technical field [0001] The invention relates to an antimicrobial peptide, in particular to an antimicrobial peptide NX-16 and its preparation method and application. Background technique [0002] Antimicrobial peptides are small molecular polypeptides with biological activity induced in organisms, usually containing 15-45 amino acid residues. Most of these active peptides have the characteristics of strong alkalinity, thermal stability and broad-spectrum antibacterial properties. The world's first antimicrobial peptide was discovered by Swedish scientist G. Boman et al. in 1980 from silkworm chrysalis. Since then, people have successively discovered and isolated polypeptides with antibacterial activity from bacteria, fungi, amphibians, insects, higher plants, mammals and even humans. Initially, it was discovered that this type of active polypeptide has broad-spectrum and high-efficiency bactericidal activity against bacteria. With the in-depth development of people's rese...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K7/08C07K16/00C12N15/11C12N15/63C12N1/15C12N1/19C12N1/21C12N5/10C12N15/70C12P21/06A61K38/10A61P31/00
Inventor胡建和杭柏林王青付登峰许明录王兰尚田田徐彦召刘兴友
OwnerHENAN INST OF SCI & TECH