Primers, probes, methods and kits for detecting campylobacter jejuni

A technology for the detection of Campylobacter jejuni, which is applied in the field of molecular biology, can solve the problems of low detection sensitivity, harsh culture conditions, and low detection rate, and achieve high detection sensitivity, shorten the detection cycle, and increase the positive rate.

Inactive Publication Date: 2011-12-07
ICDC CHINA CDC
View PDF4 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since Campylobacter jejuni is a microaerophilic bacterium, its growth requires a specific gas environment. In vitro culture requires high nutritional conditions for the culture medium, harsh culture conditions, and high cost. Conventional biochemical identification of Campylobacter Possess good technology and experience, and due to the poor consistency of biochemical identification results for differentiating bacterial strains, it may cause false identification of isolated strains, resulting in low detection sensitivity of Campylobacter jejuni in diarrhea patients and food contamination testing. , the detection rate is not high, and the detection time is slow

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers, probes, methods and kits for detecting campylobacter jejuni
  • Primers, probes, methods and kits for detecting campylobacter jejuni
  • Primers, probes, methods and kits for detecting campylobacter jejuni

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Determination of the specific DNA sequence of Campylobacter jejuni

[0042]The present invention uses BLASTn and Vector NTI Suite 6.0 software to compare the DNA sequences of all sequenced strain-specific genes of all Campylobacter jejuni published by NCBI, and screens out the specific sequence of the Campylobacter jejuni gene. The nucleotide sequence is as follows: Shown in SEQ ID NO.1.

Embodiment 2

[0043] The design of embodiment 2 campylobacter jejuni specific primers and probe

[0044] After repeated screening and verification, the present invention obtains a pair of fluorescent quantitative PCR primers for detecting Campylobacter jejuni and a TaqMan probe used in conjunction with the primers, which are synthesized by Shanghai Huirui Biology Co., Ltd. The probe is 5' labeled with the fluorescent group FAM and 3' labeled with the quencher group BHQ.

[0045] The primer sequence that the present invention obtains is:

[0046] Upstream primer: CGGATAGTTATAGTATTGAAGTTATTGG, Tm: 58°C,

[0047] Downstream primer: GAAGCAGCATAAATAGGATCTTTTG, Tm: 59°C,

[0048] The probe sequence that the present invention obtains is:

[0049] FAM-TTCTGGAGCACTTCCATGACCACC-BHQ1, Tm: 65°C.

Embodiment 3

[0050] Example 3 Establishment of a fluorescent quantitative PCR detection method for detecting Campylobacter jejuni

[0051] (1) Optimization of real-time PCR experiment parameters

[0052] Refer to Invirogen recommended fluorescent quantitative PCR 25μL system: 2×PCRUDG12.5μL, mg 2+ 3.5mM, PCR nucleotide MIX (including dNTP) 4mM, final concentration of upstream and downstream primers is 0.4μM, final concentration of probe is 0.2μM, DNA template 2μL. Optimize one condition and fix the rest. The optimal conditions were judged according to the Ct value and the strength of the fluorescent signal, and the best conditions were combined as the final optimized system.

[0053] The annealing temperature was optimized from 55°C to 65°C; the primer was optimized according to the final concentration from 0.08μM to 0.62μM; the concentration of the probe was optimized from 0.08μM to 0.36μM; mg 2+ The concentration was optimized between 1.5-5mM; the concentration of dNTPs was optimized ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
coefficient of variationaaaaaaaaaa
Login to View More

Abstract

The invention provides real-time fluorescence quantitative PCR (Polymerase Chain Reaction) primers and probe for detecting campylobacter jejuni and a method for carrying out quantitative detection by using the primers and probe. The nucleotide sequences of the primers and probe are respectively shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4. The invention also provides a kit for detecting campylobacter jejuni. The detection method and the kit thereof provided by the invention have the advantages of accurate detection, high sensitivity, strong specificity, simplicity, convenience, quicknessand good clinical specimen detection capability.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to fluorescent quantitative PCR primers and probes for detecting Campylobacter jejuni, and also relates to a method and a kit for detecting Campylobacter jejuni using the primers and probes. Background technique [0002] Campylobacter jejuni (Campylobacter jejuni) is a food-borne pathogen that mainly causes human diseases in the Campylobacter genus, and is one of the main pathogens that cause human diarrhea. Campylobacter jejuni is widely distributed. Human infection is mainly caused by Campylobacter jejuni contamination of food, drinking water and the environment. In addition to enteritis, Campylobacter jejuni infection can lead to Guillain-Barré syndrome, which brings serious disease burden to humans. . The monitoring of Campylobacter jejuni is very concerned at home and abroad. [0003] Bacterial isolation, culture and biochemical identification are commonly used methods to det...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11G01N21/64
CPCY02A50/30
Inventor张茂俊张建中乔博何利华顾一心
OwnerICDC CHINA CDC