Detection method of ecssr1024 microsatellite dna marker in white shrimp

A technology of DNA marking and white shrimp, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems that have not yet been seen in microsatellite DNA detection technology of white shrimp, and achieve the effect of convenient method

Active Publication Date: 2011-12-14
YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no report on microsatellite DNA detection technology of white shrimp

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method of ecssr1024 microsatellite dna marker in white shrimp
  • Detection method of ecssr1024 microsatellite dna marker in white shrimp

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] The detection method of EcSSR1024 microsatellite core sequence DNA molecular marker of white shrimp EcSSR1024 of the present invention comprises the following steps:

[0021] Firstly, the genomic DNA of the white shrimp was extracted and diluted for later use; then, using the microsatellite core sequence containing EcSSR1024 in the white shrimp genome library, specific primers were designed at both ends of the sequence; PCR amplification was performed on the genomic DNA of individuals within the group, and the PCR products were detected by polyacrylamide gel electrophoresis; the bands that appeared in the products were used to analyze the genotype of each individual, and the height of the EcSSR1024 core sequence region of the white shrimp was obtained. A polymorphic map of genetic variation (eg figure 1 shown).

[0022] The core sequence of EcSSR1024 of the white shrimp is GCGCACGCACGCACACAGAGAGAGAGAGAGAATGAATCATTTCCGTATTT, and the GenBank registration number is JN408...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a method for detecting an EcSSR1024 microsatellite DNA marker in exopalaemon carinicauda, which comprises: extracting genomic DNA of the exopalaemon carinicauda and diluting the genomic DNA for later use; designing specific primers at the two ends of the core sequence of an EcSSR1024 microsatellite; performing the polymerase chain reaction (PCR) amplification of the genomicDNA of the exopalaemon carinicauda by using the primers, and detecting the product of the PCR amplification; and analyzing by using strips appeared in the product, and obtaining the polymorphic map of a highly-genetic variation in the core sequence area of the EcSSR1024 in the exopalaemon carinicauda. By using the primers and detection method, which are provided by the invention, the genetic variation in the core area of the EcSSR1024 microsatellite in each individual of exopalaemon carinicauda can be detected, and the polymorphic map of the highly-genetic variation in a genetic marker gene locus in the EcSSR1024 in exopalaemon carinicaud can be obtained quickly. The method is suitable to be used in population genetic marking, genealogical identification, genetic map construction and the like.

Description

technical field [0001] The invention belongs to the microsatellite DNA molecular genetic marker technology of white shrimp, in particular to a detection method of EcSSR1024 microsatellite DNA marker of white shrimp. Background technique [0002] Microsatellites (microsatellites) or simple sequence repeats (simple sequence repeats, SSR) refers to a simple tandem repeat DNA sequence composed of 1 to 6 nucleotides. It has been found in all biological species studied so far, and its distribution density is very large. Because microsatellites are widely distributed in the genome, they have the characteristics of high density, rich polymorphism, high heterozygosity and good stability, co-dominant inheritance following Mendelian segregation law, and easy PCR amplification. It is an eye-catching new DNA marker, and is widely used in many research fields such as family genealogy authentication of biological resources, gene linkage analysis, genetic map construction, germplasm identi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 刘萍李健贾舒雯
Owner YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap