Detection method of ecssr1024 microsatellite dna marker in white shrimp
A technology of DNA marking and white shrimp, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems that have not yet been seen in microsatellite DNA detection technology of white shrimp, and achieve the effect of convenient method
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] The detection method of EcSSR1024 microsatellite core sequence DNA molecular marker of white shrimp EcSSR1024 of the present invention comprises the following steps:
[0021] Firstly, the genomic DNA of the white shrimp was extracted and diluted for later use; then, using the microsatellite core sequence containing EcSSR1024 in the white shrimp genome library, specific primers were designed at both ends of the sequence; PCR amplification was performed on the genomic DNA of individuals within the group, and the PCR products were detected by polyacrylamide gel electrophoresis; the bands that appeared in the products were used to analyze the genotype of each individual, and the height of the EcSSR1024 core sequence region of the white shrimp was obtained. A polymorphic map of genetic variation (eg figure 1 shown).
[0022] The core sequence of EcSSR1024 of the white shrimp is GCGCACGCACGCACACAGAGAGAGAGAGAGAATGAATCATTTCCGTATTT, and the GenBank registration number is JN408...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap