A rapid method for identifying whether Mycobacterium tuberculosis is dead or alive
A rapid technology for Mycobacterium tuberculosis, applied in the field of detection and identification of pathogenic microorganisms, can solve the problems of identification of dead and live bacteria of Mycobacterium tuberculosis, indistinguishable, unable to meet the requirements of rapid detection, etc. Low, high sensitivity effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0049] Example 1 Primer Design
[0050] Primers were designed according to the sequence of the conserved gene IS6100 of Mycobacterium tuberculosis, and the following 5 sets of specific primers were obtained through experimental screening:
[0051] Primer set 1:
[0052] Outer primer 1: TCATCGCCGATCATCAGG (SEQ ID No.1);
[0053] Outer primer 2: CGAGTTTGGTCATCAGCCG (SEQ ID No.2);
[0054] Internal primer 1: TGGTCGTAGTAGGTCGATGGGGGAGTCGATCTGCACACAGCT (SEQ ID No. 3);
[0055] Internal primer 2: TGCGCGATGGCGAACTCAAGGCACCGTAAACACCGTAG (SEQ ID No. 4).
[0056] Primer set 2:
[0057] Outer primer 1: ACTACGACCACATCAACCG (SEQ ID No.5);
[0058] Outer primer 2: TCAGCGATCGTGGTCCT (SEQ ID No.6);
[0059] Internal primer 1: CGGGCACCGTAAACACCGTACGATGGCGAACTCAAGGAG (SEQ ID No. 7);
[0060] Internal primer 2: AGTGTGGCTAACCCTGAACCGAGTTTGGTCATCAGCCGTTC (SEQ ID No. 8).
[0061] Primer set 3
[0062] Outer primer 1: ACGATGGCCACCTCCA (SEQ ID No.9);
[0063] Outer primer 2: CGGGTTTGATCAGCTCG...
Embodiment 2
[0077] Embodiment 2 Mycobacterium tuberculosis life-and-death identification
[0078] 1. Sample pretreatment
[0079] The sample used in this embodiment is the sputum of a patient who has been identified as Mycobacterium tuberculosis, and the sample is processed according to the following steps:
[0080] (1) Take 2ml of sputum from a tuberculosis patient in a tube, and add 4% NaOH that is 1 to 2 times the volume of the sputum sample to the sputum sample;
[0081] (2) Vortex for 15 seconds every 2 minutes, process for 15 minutes, then pipette 1ml into a centrifuge tube with a screw cap, centrifuge at 12000r / min for 15 minutes, and remove the supernatant;
[0082] (3) Add 1ml of 0.9% NaCl, wash, centrifuge at 12000r / min for 5min, and remove the supernatant;
[0083] (4) Add EMA sample treatment solution with a final concentration of 100 μg / mL, and place in the dark for 10 minutes;
[0084] (5) Then the whole tube is exposed to a 650W halogen lamp for 90s.
[0085] 2. Templat...
Embodiment 3
[0095] Example 3 Mycobacterium tuberculosis life-and-death identification
[0096] 1. Sample pretreatment
[0097] The sample used in this embodiment is the bronchial lavage fluid of a patient who has been identified as Mycobacterium tuberculosis as a sample, and is processed according to the following steps:
[0098] (1) Take 5ml of bronchial lavage fluid from tuberculosis patients in the tube, centrifuge at 1000rpm for 2 minutes, and remove the supernatant;
[0099] (2) Add EMA sample treatment solution with a final concentration of 100 μg / mL, and place in the dark for 10 minutes;
[0100] (3) Then the whole tube is exposed to a 650W halogen lamp for 5 minutes.
[0101] 2. Template DNA preparation:
[0102] (1) Boil the above treated samples in boiling water for 20 minutes and immediately place them on ice to cool for 10 minutes;
[0103] (2) Centrifuge at 10,000rpm for 2 minutes, and the supernatant can be used as template DNA to be used.
[0104] 3. Loop-mediated isot...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com