A rapid method for identifying whether Mycobacterium tuberculosis is dead or alive

A rapid technology for Mycobacterium tuberculosis, applied in the field of detection and identification of pathogenic microorganisms, can solve the problems of identification of dead and live bacteria of Mycobacterium tuberculosis, indistinguishable, unable to meet the requirements of rapid detection, etc. Low, high sensitivity effect

Inactive Publication Date: 2011-12-21
广东省结核病控制中心 +1
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since only active Mycobacterium tuberculosis is contagious and invasive, there are various detection methods for Mycobacterium tuberculosis, ranging from microbiological diagnostic methods based on smear microscopy (National Standard GB / T 14926.48-2001 ), immunological detection technology for specific antigens, nucleic acid probes, polymerase chain reaction (PCR) technology and other molecular biological detection methods are all difficult to identify dead and alive Mycobacterium tuberculosis
The current smear technique is acid-fast staining, and dead Mycobacterium tuberculosis can also be stained, so it cannot be distinguished; immunological detection technology uses the specific combination of antigen and antibody, and dead Mycobacterium tuberculosis still has the general characteristics of the antigen; As a PCR technology for genetic diagnosis, DNA is used as the detection target, and DNA still exists in dead Mycobacterium tuberculosis samples; although the culture technology can distinguish dead bacteria from live bacteria, the culture period of Mycobacterium tuberculosis is as long as 56 days. Unable to meet current requirements for rapid testing

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1 Primer Design

[0050] Primers were designed according to the sequence of the conserved gene IS6100 of Mycobacterium tuberculosis, and the following 5 sets of specific primers were obtained through experimental screening:

[0051] Primer set 1:

[0052] Outer primer 1: TCATCGCCGATCATCAGG (SEQ ID No.1);

[0053] Outer primer 2: CGAGTTTGGTCATCAGCCG (SEQ ID No.2);

[0054] Internal primer 1: TGGTCGTAGTAGGTCGATGGGGGAGTCGATCTGCACACAGCT (SEQ ID No. 3);

[0055] Internal primer 2: TGCGCGATGGCGAACTCAAGGCACCGTAAACACCGTAG (SEQ ID No. 4).

[0056] Primer set 2:

[0057] Outer primer 1: ACTACGACCACATCAACCG (SEQ ID No.5);

[0058] Outer primer 2: TCAGCGATCGTGGTCCT (SEQ ID No.6);

[0059] Internal primer 1: CGGGCACCGTAAACACCGTACGATGGCGAACTCAAGGAG (SEQ ID No. 7);

[0060] Internal primer 2: AGTGTGGCTAACCCTGAACCGAGTTTGGTCATCAGCCGTTC (SEQ ID No. 8).

[0061] Primer set 3

[0062] Outer primer 1: ACGATGGCCACCTCCA (SEQ ID No.9);

[0063] Outer primer 2: CGGGTTTGATCAGCTCG...

Embodiment 2

[0077] Embodiment 2 Mycobacterium tuberculosis life-and-death identification

[0078] 1. Sample pretreatment

[0079] The sample used in this embodiment is the sputum of a patient who has been identified as Mycobacterium tuberculosis, and the sample is processed according to the following steps:

[0080] (1) Take 2ml of sputum from a tuberculosis patient in a tube, and add 4% NaOH that is 1 to 2 times the volume of the sputum sample to the sputum sample;

[0081] (2) Vortex for 15 seconds every 2 minutes, process for 15 minutes, then pipette 1ml into a centrifuge tube with a screw cap, centrifuge at 12000r / min for 15 minutes, and remove the supernatant;

[0082] (3) Add 1ml of 0.9% NaCl, wash, centrifuge at 12000r / min for 5min, and remove the supernatant;

[0083] (4) Add EMA sample treatment solution with a final concentration of 100 μg / mL, and place in the dark for 10 minutes;

[0084] (5) Then the whole tube is exposed to a 650W halogen lamp for 90s.

[0085] 2. Templat...

Embodiment 3

[0095] Example 3 Mycobacterium tuberculosis life-and-death identification

[0096] 1. Sample pretreatment

[0097] The sample used in this embodiment is the bronchial lavage fluid of a patient who has been identified as Mycobacterium tuberculosis as a sample, and is processed according to the following steps:

[0098] (1) Take 5ml of bronchial lavage fluid from tuberculosis patients in the tube, centrifuge at 1000rpm for 2 minutes, and remove the supernatant;

[0099] (2) Add EMA sample treatment solution with a final concentration of 100 μg / mL, and place in the dark for 10 minutes;

[0100] (3) Then the whole tube is exposed to a 650W halogen lamp for 5 minutes.

[0101] 2. Template DNA preparation:

[0102] (1) Boil the above treated samples in boiling water for 20 minutes and immediately place them on ice to cool for 10 minutes;

[0103] (2) Centrifuge at 10,000rpm for 2 minutes, and the supernatant can be used as template DNA to be used.

[0104] 3. Loop-mediated isot...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for quickly identifying the life and death of Mycobacterium tuberculosis, the principle of which is to combine ethidium azide bromide with ring-mediated constant temperature nucleic acid amplification technology, and design four specific Using four specific primers and a DNA polymerase with strand displacement activity to amplify the sample DNA template at 63~65°C, the short-term amplification efficiency can reach 109~1010 copies, observed by adding SYBRGreenI The color changes to judge whether it is amplified or not. The method of the invention has the advantages of short detection time, strong specificity and high sensitivity, and the identification accuracy rate of dead and alive mycobacterium tuberculosis reaches over 99%, and can be widely used in detection and identification of clinical and disease control departments.

Description

technical field [0001] The invention relates to the detection and identification of pathogenic microorganisms, in particular to a method for quickly identifying the life and death of mycobacterium tuberculosis by using a loop-mediated isothermal nucleic acid amplification technique. Background technique [0002] Tuberculosis is still one of the most serious bacterial infectious diseases on human health in the world. According to the statistics of the World Health Organization, there are 20 million tuberculosis patients in the world, about 9 million new cases occur every year, and 3 million people die every year. , About 1 / 3 of the population has latent Mycobacterium tuberculosis infection. Tuberculosis is on the rise due to population growth, immigration, tourism, drug resistance, the prevalence of human immunodeficiency virus infection, drug abuse, alcohol abuse, and poverty. [0003] So far, the identification of dead and live bacteria has always been one of the major pro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12R1/32
Inventor钟球石磊周琳常彦磊叶宇鑫陈涛唐大运
Owner广东省结核病控制中心