Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for constructing genetically engineered Escherichia coli using xylose metabolism to produce succinate

A technology of genetically engineering bacteria and producing succinic acid, applied in the field of bioengineering, can solve the problems of wasting resources, polluting the environment, etc., and achieve the effect of efficient utilization

Inactive Publication Date: 2011-12-28
NANJING UNIV OF TECH
View PDF0 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, except for the use in the paper industry, most of them are discarded, which seriously wastes resources and pollutes the environment.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing genetically engineered Escherichia coli using xylose metabolism to produce succinate
  • Method for constructing genetically engineered Escherichia coli using xylose metabolism to produce succinate
  • Method for constructing genetically engineered Escherichia coli using xylose metabolism to produce succinate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] This example illustrates the construction of an expression plasmid that overexpresses phosphoenolpyruvate carboxykinase, restores the ability of the recombinant strain to metabolize xylose under anaerobic conditions, and obtains the strain Escherichia coli BA204.

[0055] 1. Lack of lactate dehydrogenase gene ( wxya ), pyruvate formate lyase gene ( PPML ) Active E. coli The NZN111 strain was the starting strain, and the phosphoenolpyruvate carboxylase (PPC) gene was knocked out to obtain simultaneous deficiency wxya , PPML and PPC competent strains.

[0056] Knockout of the phosphoenolpyruvate carboxylase (PPC) gene using homologous recombination technology: using the apramycin resistance gene with FRT sites on both sides as a template, using a high-fidelity PCR amplification system, and designing Amplification primers with PPC homologous fragments at both ends successfully amplified linear DNA homologous fragments; a plasmid capable of inducing the expressi...

Embodiment 2

[0064] This example illustrates the construction of an expression plasmid co-expressing phosphoenolpyruvate carboxykinase and malic enzyme, restoring the ability of the recombinant strain to metabolize xylose under anaerobic conditions, and obtaining the strain Escherichia coli BA205.

[0065] 1. Lack of lactate dehydrogenase gene ( wxya ), pyruvate formate lyase gene ( PPML ) Active E. coli The NZN111 strain was the starting strain, and the phosphoenolpyruvate carboxylase (PPC) gene was knocked out to obtain simultaneous deficiency wxya , PPML And the competent bacterial strain of PPC (same as embodiment 1).

[0066] 2. Construction of an expression plasmid co-expressing phosphoenolpyruvate carboxykinase and malic enzyme, the process comprising:

[0067] (1) Both the upstream and downstream of the synthesis have Hin primers for the dIII restriction site,

[0068]Upstream primer: 5'- CCCAAGCTTATGAACTCAGTTGATTTGACCG -3';

[0069] Downstream primer: 5'-CCCAAGCTTG...

Embodiment 3

[0073] This example illustrates the construction of an expression plasmid co-expressing phosphoenolpyruvate carboxykinase and malate dehydrogenase, restoring the ability of the recombinant strain to metabolize xylose under anaerobic conditions, and obtaining the strain Escherichia coli BA206.

[0074] 1. Lack of lactate dehydrogenase gene ( wxya ), pyruvate formate lyase gene ( PPML ) Active E. coli The NZN111 strain was the starting strain, and the phosphoenolpyruvate carboxylase (PPC) gene was knocked out to obtain simultaneous deficiency wxya , PPML And the competent bacterial strain of PPC (same as embodiment 1).

[0075] 2. Construction of an expression plasmid co-expressing phosphoenolpyruvate carboxykinase and malate dehydrogenase, the process comprising:

[0076] (1) Both the upstream and downstream of the synthesis have Hin Primers for the dIII restriction site,

[0077] Upstream primer: 5'- CCCAAGCTTATGAACTCAGTTGATTTGACCG -3';

[0078] Downstream pri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Provided is a construction method of an escherichia coli genetically engineered bacteria producing succinic acid by xylose metabolism and the method for producing succinic acid by fermentation using the bacteria. The ATP biosynthesis pathway of escherichia coli is modified by means of molecular biology and the enzyme activity related to the pathway is over-expressed; thus the total ATP amount within escherichia coli cells is effectively increased such that the recombinant escherichia coli is able to grow using xylose metabolism, and the succinic acid synthesis efficiency is thereby significantly improved.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and relates to a method for constructing a genetically engineered bacterium of Escherichia coli producing succinate by utilizing xylose metabolism. Background technique [0002] Succinic acid, also known as succinic acid, is widely used in industries such as medicine, pesticides, dyes, spices, paints, food and plastics. As a C4 platform compound, it can be used to synthesize 1,4-butanediol, tetrahydrofuran, Organic chemicals such as γ-butyrolactone and biodegradable materials such as polybutylene succinate (PBS) are considered by the US Department of Energy to be among the 12 most valuable biorefinery products in the future. [0003] The production methods of succinic acid mainly include chemical synthesis and microbial fermentation, using microbial fermentation to convert renewable resources (glucose, xylose, etc.). can absorb and fix CO 2 , can effectively alleviate the greenhouse effe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12P7/46C12R1/19
CPCC12N9/93C12R1/19C12N15/70C12N9/0006C12N15/63C12N9/88C12P7/46C12N15/52C12Y401/01031C12N15/67
Inventor 姜岷刘嵘明梁丽亚马江锋陈可泉韦萍
Owner NANJING UNIV OF TECH