Method for studying structural diversity of daqu bacterial community

A technology of community structure and diversity, applied in biochemical equipment and methods, determination/inspection of microorganisms, etc., can solve the problem of inseparability of microorganisms, which is difficult to directly study, and achieve the effect of avoiding a large number of losses.

Inactive Publication Date: 2012-03-21
CHINA NAT RES INST OF FOOD & FERMENTATION IND CO LTD
View PDF1 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is aimed at the problems existing in the existing research methods of Daqu microorganisms, in order to solve the technical problems that some microorganisms are difficult to directly study due to inseparability, and provide a method for studying the diversity of bacterial community structure in liquor Daqu

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for studying structural diversity of daqu bacterial community
  • Method for studying structural diversity of daqu bacterial community
  • Method for studying structural diversity of daqu bacterial community

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0009] For better understanding of the present invention, below in conjunction with example further elaborates the present invention.

[0010] a) Daqu samples selected for analysis (different batches and different types of Luzhou-flavor liquor Daqu from the same origin);

[0011] b) Weighing 1 g of Daqu sample, adding the extract to extract the genomic DNA in the sample;

[0012] c) Select the primer pair F338gc and the R518 primer pair specific to the 16S rRNA gene V3 region of most bacteria and archaea, and add a GC hairpin structure at the 5' end of the forward primer of the primer pair. The sequence of the primer pair is : F338gc: (5′- CGC CCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG ACTCCTACGGAGGCAGCAG-3', the underlined part is the hairpin structure), R518: (5'-ATTACCGCGGCTGCTGG-3');

[0013] d) Use the genomic DNA extracted in step b) as a template, and use the primer pair in step c) as primers for PCR amplification. The PCR reaction system is: 50 μL of the PCR reaction sy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for studying the structural diversity of a daqu bacterial community, i.e. the denaturing gradient gel electrophoresis (DGGE) technology, which belongs to the technical field of microbial ecology and mainly comprises the following steps that: 1), daqu genomic deoxyribonucleic acid (DNA) is directly extracted; 2), bacterial universal primers are selected, and specific DNA fragments in the bacterial ribosome DNA are amplified; 3), polymerase chain reaction (PCR) products are separated through DGGE; 4), corresponding strips of microbes in the DGGE fingerprint map are recovered in a gel cutting way; 5), PCR is carried out again, products are connected to a T carrier, the blue and white spot screening is carried out, and positive clone verification is carried out; and 6), the species information of the corresponding microbes of the DGGE strips is obtained through the sequence test. The method does not rely on the molecular biology technology of the traditional culture method, has the characteristics of sensitivity, convenience and accuracy and solves the difficult problems to study some microbes incapable of being cultured or difficult to culture, and the method provides the technical basis for the verification of the daqu bacterial community structure and the discovery of new wine brewing microbes or functional microbes.

Description

technical field [0001] DGGE technology belongs to the field of microbial ecology. In traditional fermented foods, it is often used in the analysis of microbial diversity, microbial dynamic monitoring, analysis of metabolic activity, discovery of new microbial resources, product quality control, etc. In addition, it is used for research and discovery of fermentation processes The medium-dominant / functional microorganisms and the identification of origin also show strong vitality. Background technique [0002] In 1993, Muyzer et al. applied DGGE technology to microbial ecology research for the first time, and confirmed that this molecular biology technology has unique advantages in revealing genetic diversity, population differences and bacterial identification of complex microbial flora in artificial or natural environments. . The basic principle of DGGE is that DNA fragments with different sequences have different mobility due to their different melting behaviors on gels wi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12Q1/04
Inventor熊正河钟其顶孟镇
OwnerCHINA NAT RES INST OF FOOD & FERMENTATION IND CO LTD