Application of soybean GmCOL4 gene in regulation and control of florescence of plants

A flowering period regulation and plant technology, applied in the field of genetic engineering, can solve problems such as changing plant sensitivity and flowering time, and achieve the effect of inhibiting plant flowering and prolonging plant growth period

Inactive Publication Date: 2012-04-04
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Changing plant sensitivity to photoperiod and flowering time by modulating soybean flowering gene expression has also not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of soybean GmCOL4 gene in regulation and control of florescence of plants
  • Application of soybean GmCOL4 gene in regulation and control of florescence of plants
  • Application of soybean GmCOL4 gene in regulation and control of florescence of plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Example 1 Cloning of Soybean Flowering Gene GmCOL4

[0019] CO homologous genes were amplified from soybean 'Kennong 18' (Glycine max L. Kennong 18') leaf cDNA using forward primer 5'-ATGGGTTATATGTGATTTTTGTG-3' and reverse primer 5'TCAGCAGCTTCTGGTTGTGC 3', respectively.

[0020] The PCR reaction program was: 95°C 5min pre-denaturation, 95°C 30S, 50°C 35S, 72°C 2min, 25 cycles, 72°C 10min extension.

[0021] The amplified PCR product was cloned directly according to the TA cloning method into such as figure 1 on the indicated pGWCm vector. Firstly, the pGWCm vector was hydrolyzed with Ahd I endonuclease, and then the digested product was recovered with a gel recovery kit to obtain the T vector. Then the PCR product and the T vector were ligated at 16° C., the ligated product was transformed into Escherichia coli DH5a, amplified therein, positive clones were screened and sequenced.

Embodiment 2

[0022] Example 2 Amino Acid Sequence Analysis of Protein Encoded by Soybean Flowering Gene GmCOL4

[0023] The homology between the GmCOL4 protein sequence of the soybean flowering gene and Arabidopsis is only 24%, and there are several key amino acid differences in the conserved functional domain (two B-boxes and one CCT domain), such as figure 2 shown. Therefore, it is speculated that the functions of GmCOL4 and Arabidopsis CO may be different, and may have the activity of inhibiting plant flowering.

Embodiment 3

[0024] Example 3 Expression levels of soybean flowering gene GmCOL4 in different tissues and organs and different developmental stages in soybean

[0025] The expression of soybean flowering gene GmCOL4 in soybean was determined by quantitative real time RT-PCR. Real-time fluorescent quantitative PCR was carried out using ABI StepOne, and SYBR Green I was used to detect the fluorescent signal. Upstream primer: 5'-ACCCTTTGAGCACAACCAGA-3', downstream primer: 5'-GTTTTTCTTTTGCTACTATAGGACTG-3'. The reaction system is:

[0026] SYBR Primix Ex Taq(2×)(TaKaRa) 7.5μl

[0027] Upstream primer (10μM) 0.3μl

[0028] Downstream primer (10μM) 0.3μl

[0029] ROX Reference Dye (50x) 0.3μl

[0030] cDNA 1.0μl

[0031] Sterilized double distilled water 5.6μl

[0032] The reaction parameters are two-step method: 95°C 10S, hot start; 95°C 5S, 60°C 1min, 40 cycles. Gene expression was normalized and plotted using gene chip data analysis software Genesis.

[0033] The soybean flowering gen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Upstream primeraaaaaaaaaa
Login to view more

Abstract

The invention relates to the field of genetic engineering and especially to application of the soybean flowering gene GmCOL4 in regulation and control of florescence of plants. Overexpression of GmCOL4 enables flowering of a plant (Arabidopis thaliana) to be inhibited obviously, flowering time to be delayed and a growth period to be prolonged. The invention can be used for overcoming the problem of flowering asynchronism in crossbreeding, the problem of growth period controlling of a variety of crops, vegetable, fruit and flowers, the problem of photoperiod sensitivity and the problem of introduction.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to the application of a soybean flowering gene in the regulation of plant flowering. Background technique [0002] Soybean is one of the important crops, and it is an important source of plant protein, edible oil, biodiesel, and secondary metabolites such as isoflavones and lecithin. Because soybean is a short-day plant, flowering is strictly controlled by photoperiod, so excellent varieties in different regions cannot be introduced to each other, and the growth period is also restricted by environmental photoperiod (Zhang et al., 2008). If the sensitivity of soybean to photoperiod can be reduced, and the limitation of soybean flowering to photoperiod can be broken, the problem of soybean introduction can be solved, so as to realize the mutual exchange of high-quality varieties in various regions, enrich excellent germplasm resources in various regions, and regulate the growth per...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/29A01H5/00
Inventor 傅永福张晓玫
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap