Check patentability & draft patents in minutes with Patsnap Eureka AI!

Fumonisins B1 aptamer and applications thereof

A fumonisin and nucleic acid aptamer technology, applied in the biological field, can solve the problems of high production cost, large batch-to-batch variation, and rapid development of immunological detection technologies such as restriction enzyme-linked immunosorbent assay, and achieve repeatability and stability. Good, high affinity and specificity, good application prospects

Inactive Publication Date: 2012-06-27
CHINA NAT ACAD NANOTECH & ENG
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the aforementioned methods have high sensitivity and specificity, they require complex purification steps and expensive instruments and equipment, and are not easy to be popularized and used; ELISA detection technology based on monoclonal antibodies or polyclonal antibodies has the characteristics of simple, fast and sensitive , can detect a large number of samples at the same time, compared with the HPLC method and LC-MS method, it has the advantages of high sensitivity, less interference, simple and fast determination steps, safe operation, less equipment investment, and accurate and reliable determination results
However, for FB, a toxic small molecule, the preparation cycle of the antibody is long, the production cost is high, the technology is difficult, the batch-to-batch variation is large, and the clone (cell) is difficult to effectively preserve, which greatly limits the ability of enzyme-linked immunosorbent assay, etc. The rapid development of immunological detection technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fumonisins B1 aptamer and applications thereof
  • Fumonisins B1 aptamer and applications thereof
  • Fumonisins B1 aptamer and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0047] Example: a fumonisin B1 nucleic acid aptamer, characterized in that it is a nucleotide sequence

[0048] A DNA molecule represented by GCATCACTACAGTCATTACGCATCGCGAGGGGACGGGAACGCGCTGAAGGGAGGCCTAGGATCGTGTGAAGTGCTGTCCC or its complementary nucleotide sequence.

[0049] In the present invention, the single-stranded DNA random library and primers used for SELEX are synthesized by Takara Company. The two ends are fixed sequences, and the middle is a random sequence of 35 bases: 5'GCATCACTACAGTCATTACGCATCG-(N35)-ATCGTGTGAAGTGCTGTCCC 3', the library capacity is Above 1014, primer 1: 5'GCATCACTACAGTCATTACGCA-3', primer 2: 5'GGGACAGCACTTCACACGAT 3', primer 3: 5'GCGTAATGACAAAAAAAAAAAACAT-C6-NH23', primer 4: 5'Biotin-GGGACAGCACTTCACACGAT 3'. Fumonisin B1 was purchased from ALEXIS Company, magnetic beads were purchased from Invitrogen Company, oligonucleotide purification reagents were purchased from Qiagen Company, and PCR kits and T vectors were purchased from Promega Company.

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention relates to an aptamer combined with high specificity and high affinity of Fumonisins B1 and applications thereof. The aptamer can be used for detection and analysis and separation and concentration of the Fumonisins B1, and has the characteristics of high specificity, high affinity, uniform quality, high stability, short development cycle, low production cost and convenience in use. The invention also relates to sequences derived from aptamer sequences, which comprise modified sequences.

Description

(1) Technical field: [0001] The invention belongs to the field of biotechnology, and relates to the design and preparation of a fumonisin B1 nucleic acid aptamer combined with fumonisin B1 with high specificity and high affinity by using molecular biology technology - SELEX technology and its application. (two) background technology: [0002] Fumonisins (Fumoni sins, FB) are mainly secondary metabolites produced by fungi F. moniliforme and F. proliferatum, which are diester compounds of polyhydric alcohols and glycerin tricarboxylic acid, which exist in a wide range from millet to grains Fruits such as bananas can be contaminated and exist in various links such as processing, storage, and transportation. Through grain processing, feed production, and other processes, it will cause serious harm to animal husbandry and even human health. Fumonisins mainly include fumonisins B1, B2 and B3, of which more than 60% are fumonisins B1 (FB1). FB1 is the most toxic fumonisins. Isolat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/115C07C219/06C07C213/10C12Q1/68G01N21/64
Inventor 吴淑庆杨在明张良
Owner CHINA NAT ACAD NANOTECH & ENG
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More