Stress-resistant protein PpLEA3-17 of bryophyte as well as encoding gene and application thereof

A technology encoding genes and proteins, applied in the direction of plant gene improvement, application, plant peptides, etc., to achieve the effect of improving drought tolerance

Inactive Publication Date: 2012-07-04
CAPITAL NORMAL UNIVERSITY +1
View PDF1 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The most critical technical bottleneck in this method is the screening and functional discovery of effective stress-resistant genes.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Stress-resistant protein PpLEA3-17 of bryophyte as well as encoding gene and application thereof
  • Stress-resistant protein PpLEA3-17 of bryophyte as well as encoding gene and application thereof
  • Stress-resistant protein PpLEA3-17 of bryophyte as well as encoding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045]Example 1. Screening of moss stress tolerance-related protein PpLEA3-17 encoding gene PpLEA3-17 and its cDNA clone.

[0046] Physcomitrella patens drought treatment: Physcomitrella patens (Physcomitrella patens) grown on BCD medium (Geng Xuke et al., 2008 Plant Gene Targeting——Application of Model Plant Physcomitrella patens. Biological Bulletin, 43 (4) : 13-15; the public can obtain from Capital Normal University) the stem and leaf bodies are transferred to the soaked filter paper, put into a 500ml beaker, and seal with absorbent paper. The drought treatment is carried out in a cultivation room with a temperature of 24±1° C. and a relative humidity of 30±5%.

[0047] After 3 days, the dry stem and leaf bodies were taken out for protein extraction; the stem and leaf bodies grown under normal conditions were used as a control.

[0048] The protein extraction of Physcomitrella patens stem and leaf body adopts phenol extraction method. Proteins from normal and drought con...

Embodiment 2

[0051] Embodiment 2, transfer PpLEA3-17 gene to cultivate drought-tolerant plants

[0052] 1) Construction of PpLEA3-17 expression vector pCU-PpLEA3-17

[0053] The maize Ubiquitin promoter shown in Sequence 3 in the sequence listing (using AAGCTTTCTTAGTGCAGTGCAGCGTGAC and CTGCAGCCTCTAGTGCAGAAGTAACACCA as primers and amplified from maize genomic DNA) was inserted into the plant binary expression vector pC1390 (the vector can be purchased from Cambia, Queensland.Australia) Between the HindIII and KpnI sites, an intermediate vector pC1390-Ubi is formed. The cDNA fragment of the amplified PpLEA3-17 gene was double-digested with SpeI and KpnI, and inserted between the SpeI and KpnI sites of the intermediate vector pC1390-Ubi forward (the inserted gene is just behind the Ubiquitin promoter), Get the recombinant vector. The recombinant vector containing the PpLEA3-17 gene of the deoxyribonucleotides 1-583 from the 5' end of sequence 1 in the sequence listing is named pCU-PpLEA3-17...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses stress-resistant protein PpLEA3-17 of bryophyte as well as an encoding gene and an application thereof. The protein related to the plant stress resistance and provided by the invention is named as PpLEA3-17, is from physcomitrella patens and is the protein in 1) or 2): (1) the protein consisting of amino acid sequences shown by the sequence 2 in a sequence table; and 2) the protein which is obtained by the amino acid residue sequence of the sequence 2 in the sequence table through substitution and / or deletion and / or addition of one or more amino acid residues, is related to the plant stress resistance and is derived by 1). The experiment for introducing the encoding gene of the PpLEA3-17 disclosed by the invention into wild type rice (Nipponbare) can prove that thesurvival rate (80.4%, 68.1%, 91.8% and 69.4%) and the growing state of four T2-substituted trans-PpLEA3-17-gene plant (17-1, 17-2, 17-3 and 17-4) in the drought stress experiment are obviously betterthan those of the control plant.

Description

technical field [0001] The invention relates to bryophyte stress tolerance protein PpLEA3-17, its coding gene and application. Background technique [0002] Stress factors such as drought, salinity, and low temperature in the natural environment have an important impact on the growth and development of plants. In severe cases, they will cause large-scale crop yield reduction. Cultivating stress-tolerant crops is one of the main goals of planting. At present, it is an effective method to obtain stress-tolerant crop varieties through genetic engineering breeding. The most critical technical bottleneck in this method is the screening and function discovery of effective stress resistance genes. [0003] Bryophytes are terrestrial pioneer plants that appeared in the Paleo-Ordovician period 500 million years ago. In their life history, the gametophyte of the "stem and leaf body" is the main vegetative growth stage. The "stem and leaf body" leaves are composed of a single layer o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N5/10C07H21/04
Inventor 何奕騉崔素霞路铁刚张治国胡勇曹保久宋晓璇郭士磊胡家蔺平亮宋旸王丽颖
Owner CAPITAL NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap