Stress-resistant protein PpLEA3-17 of bryophyte as well as encoding gene and application thereof
A technology encoding genes and proteins, applied in the direction of plant gene improvement, application, plant peptides, etc., to achieve the effect of improving drought tolerance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045]Example 1. Screening of moss stress tolerance-related protein PpLEA3-17 encoding gene PpLEA3-17 and its cDNA clone.
[0046] Physcomitrella patens drought treatment: Physcomitrella patens (Physcomitrella patens) grown on BCD medium (Geng Xuke et al., 2008 Plant Gene Targeting——Application of Model Plant Physcomitrella patens. Biological Bulletin, 43 (4) : 13-15; the public can obtain from Capital Normal University) the stem and leaf bodies are transferred to the soaked filter paper, put into a 500ml beaker, and seal with absorbent paper. The drought treatment is carried out in a cultivation room with a temperature of 24±1° C. and a relative humidity of 30±5%.
[0047] After 3 days, the dry stem and leaf bodies were taken out for protein extraction; the stem and leaf bodies grown under normal conditions were used as a control.
[0048] The protein extraction of Physcomitrella patens stem and leaf body adopts phenol extraction method. Proteins from normal and drought con...
Embodiment 2
[0051] Embodiment 2, transfer PpLEA3-17 gene to cultivate drought-tolerant plants
[0052] 1) Construction of PpLEA3-17 expression vector pCU-PpLEA3-17
[0053] The maize Ubiquitin promoter shown in Sequence 3 in the sequence listing (using AAGCTTTCTTAGTGCAGTGCAGCGTGAC and CTGCAGCCTCTAGTGCAGAAGTAACACCA as primers and amplified from maize genomic DNA) was inserted into the plant binary expression vector pC1390 (the vector can be purchased from Cambia, Queensland.Australia) Between the HindIII and KpnI sites, an intermediate vector pC1390-Ubi is formed. The cDNA fragment of the amplified PpLEA3-17 gene was double-digested with SpeI and KpnI, and inserted between the SpeI and KpnI sites of the intermediate vector pC1390-Ubi forward (the inserted gene is just behind the Ubiquitin promoter), Get the recombinant vector. The recombinant vector containing the PpLEA3-17 gene of the deoxyribonucleotides 1-583 from the 5' end of sequence 1 in the sequence listing is named pCU-PpLEA3-17...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
