Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Vegetable glutelin transportation storage related protein OsVps9a as well as coding gene and application thereof

A related protein and gluten technology, applied in plant gluten transport and storage related protein OsVps9a and its encoding gene and application field

Inactive Publication Date: 2012-07-25
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in rice, the function of the protein containing the VPS9 domain has not been studied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vegetable glutelin transportation storage related protein OsVps9a as well as coding gene and application thereof
  • Vegetable glutelin transportation storage related protein OsVps9a as well as coding gene and application thereof
  • Vegetable glutelin transportation storage related protein OsVps9a as well as coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1. Discovery of glutenin transport and storage-related proteins and their encoding genes in plant seeds

[0052] 1. Distribution analysis and genetic analysis of mature glutenin content of rice mature glutenin-reducing mutant T5390

[0053] In the japonica rice variety Nipponbare mutant library (from the Chinese Academy of Agricultural Sciences), using protein electrophoresis analysis, a strain with reduced mature glutenin content in seeds was screened, and its gluten precursor was significantly increased compared with the normal type, named for T5390.

[0054] Compared with Nipponbare, the main characteristics of T5390 are: the content of mature gluten in the seeds is reduced (see figure 1 ), with massive accumulation of proglutenin and a seed opaque phenotype, see figure 2 . Panel A shows that Nipponbare has translucent endosperm and panel B shows that T5390 endosperm is opaque.

[0055] Transmission electron microscopy of developing endosperm revealed t...

Embodiment 2

[0092] Embodiment 2, the acquisition and identification of transgenic plants

[0093] 1. Construction of recombinant expression vector

[0094] The OsVps9a gene was obtained by PCR amplification using the genomic DNA of Nipponbare (from the germplasm resource bank of the Rice Institute of Nanjing Agricultural University) as a template. The PCR primer sequences are as follows:

[0095] primer3:

[0096] 5'AATTCGAGCTCGGTACCCGGGCGTAGTGGCTTATTGCTCCCTGAT 3'

[0097] (SEQ ID NO.6);

[0098] primer4:

[0099] 5'CGACTCTAGAGGATCCCCGGGCACTGTACGGGTTGTTGAATGAGAC 3'

[0100] (SEQ ID NO. 7).

[0101] The above primers are located at the upstream 2kb and downstream 1.5kb of the gene shown in SEQ ID NO.2, the amplified product contains the promoter part of the gene, and the PCR product is recovered and purified. The PCR product was cloned into the vector pCAMBIA1305 using the INFUSION recombination kit (Takara, Japan).

[0102] INFUSION recombination reaction system (10 μL): 1.0 μL of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a vegetable glutelin transportation storage related protein OsVps9a as well as a coding gene and application thereof. The protein is selected from (a) or (b) as follows: (a) protein formed by an amino acid sequence shown in SEQ ID NO.1; and (b) protein for replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO.1, related to the vegetable glutelin transportation storage and derived from the SEQ ID NO.1. Vegetables with normal mature glutelin content can be cultivated by introducing the coding gene of the protein into vegetables with lowered mature glutelin content. The protein and the coding gene can be applied in the genetic improvement of vegetables.

Description

technical field [0001] The invention belongs to the field of genetic engineering and relates to a plant gluten protein transport and storage related protein OsVps9a, its coding gene and application. Background technique [0002] Higher plants accumulate a large amount of storage substances in their seeds during the reproductive period, and plant seeds have thus become the main source of food for humans. Rice (Oryza sativa L.) is one of the most important food crops in the world, and more than 50% of the world's population takes rice as the main ration. Rice contains a large amount of storage protein, which is the second largest substance in rice after starch. Therefore, in-depth research on storage protein is of great significance for improving the eating quality and nutritional quality of rice. [0003] The storage proteins in rice seeds account for about 8-10% of the grain dry weight, of which glutenin accounts for 60-80%, and prolamin accounts for 18-20%. Among them, g...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21C12N15/11C12N15/82A01H5/00
Inventor 万建民刘峰王益华鲍依群任玉龙江玲
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products