Vegetable glutelin transportation storage related protein OsVps9a as well as coding gene and application thereof
A related protein and gluten technology, applied in plant gluten transport and storage related protein OsVps9a and its encoding gene and application field
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] Example 1. Discovery of glutenin transport and storage-related proteins and their encoding genes in plant seeds
[0052] 1. Distribution analysis and genetic analysis of mature glutenin content of rice mature glutenin-reducing mutant T5390
[0053] In the japonica rice variety Nipponbare mutant library (from the Chinese Academy of Agricultural Sciences), using protein electrophoresis analysis, a strain with reduced mature glutenin content in seeds was screened, and its gluten precursor was significantly increased compared with the normal type, named for T5390.
[0054] Compared with Nipponbare, the main characteristics of T5390 are: the content of mature gluten in the seeds is reduced (see figure 1 ), with massive accumulation of proglutenin and a seed opaque phenotype, see figure 2 . Panel A shows that Nipponbare has translucent endosperm and panel B shows that T5390 endosperm is opaque.
[0055] Transmission electron microscopy of developing endosperm revealed t...
Embodiment 2
[0092] Embodiment 2, the acquisition and identification of transgenic plants
[0093] 1. Construction of recombinant expression vector
[0094] The OsVps9a gene was obtained by PCR amplification using the genomic DNA of Nipponbare (from the germplasm resource bank of the Rice Institute of Nanjing Agricultural University) as a template. The PCR primer sequences are as follows:
[0095] primer3:
[0096] 5'AATTCGAGCTCGGTACCCGGGCGTAGTGGCTTATTGCTCCCTGAT 3'
[0097] (SEQ ID NO.6);
[0098] primer4:
[0099] 5'CGACTCTAGAGGATCCCCGGGCACTGTACGGGTTGTTGAATGAGAC 3'
[0100] (SEQ ID NO. 7).
[0101] The above primers are located at the upstream 2kb and downstream 1.5kb of the gene shown in SEQ ID NO.2, the amplified product contains the promoter part of the gene, and the PCR product is recovered and purified. The PCR product was cloned into the vector pCAMBIA1305 using the INFUSION recombination kit (Takara, Japan).
[0102] INFUSION recombination reaction system (10 μL): 1.0 μL of ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap