Identification and use of plant root-specific expression promoter
A plant-specific technology, applied to isolated DNA, the application field of the DNA can solve the problems of different sequence structures, unpredictable root-specific promoters, etc., to achieve the effect of increasing yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0102] Embodiment 1. Isolation and Characterization of Promoter KT630P
[0103] Design the primers required for cloning the promoter KT630P as follows:
[0104] Primer 1: 5'-CCCaagctt GCTATATGTGTACGTGATAGTATAT -3'
[0105] Primer 2: 5'-CGggatcc TTAATTTGCTCTTGTATTAGCTTCTA -3'
[0106] The sequence aagctt in primer 1 is the restriction site of HindIII, and the sequence ggatcc in primer 2 is the restriction site of BamHI.
[0107] Using the forward and reverse primers of the promoter (the underlined part is the promoter sequence), the genomic DNA of rice (Zhonghua 11) extracted with the Plant Genomic DNA Extraction Kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.) was used as The template was amplified, and the reaction conditions were: pre-denaturation at 95°C for 5 minutes; denaturation at 94°C for 30 seconds; annealing at 55°C for 30 seconds; extension at 72°C for 1 minute; 30 cycles; extension at 72°C for 10 minutes. After the reaction, the PCR products were...
Embodiment 2
[0108] Embodiment 2. Construction of expression vector
[0109] The pEASY-T1 plasmid that has been inserted into the KT630P promoter sequence verified by sequencing was digested with HindIII and BamHI, and connected to the vector pHPG that was also digested with HindIII and BamHI, and the colonies were picked for PCR detection, and the PCR results were positive. The colony was sequenced, and after the sequencing was verified to be correct, the corresponding positive clone plasmid was extracted and named pHPG-KT630P. Among them, the primers required for colony PCR detection are the primers on the pHPG carrier, located on both sides of the cloned promoter fragment, the amplified fragment is about the length of the promoter, and the bacterial liquid is used as a template for amplification detection. The PCR reaction conditions are: 95 Pre-denaturation at ℃ for 5 minutes; denaturation at 94°C for 30 seconds; annealing at 55°C for 30 seconds; extension at 72°C for 1 minute; 34 c...
Embodiment 3
[0111] Embodiment 3. Plant transformation and functional characterization
[0112] The plasmid pHPG-KT630P was transformed into Agrobacterium AGLO strain by heat shock method, rice was co-transformed by Agrobacterium-mediated method, and Arabidopsis plants were transformed by Agrobacterium inflorescence infection method. Isolate tissues and organs from transgenic plants for GUS activity detection, place each tissue and organ in a centrifuge tube containing GUS staining buffer, incubate overnight in a 37°C incubator, and then decolorize in absolute ethanol at room temperature save.
[0113] 3.1 Tissue and organ staining of transgenic rice seedlings
[0114] The hygromycin-resistant rice callus obtained by transforming the KT630P promoter was subjected to a GUS staining experiment, and the results were as follows: figure 2 As shown in B, there is no visible blue color in the resistant callus, indicating that there is basically no expression of the GUS gene in this tissue. ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More