Device and method for capturing specificity of circulating cancer cells in peripheral blood

A technology for circulating cancer cells and peripheral blood, which is applied to tumor/cancer cells, biological material sampling methods, animal cells, etc. It can solve the problems of long pretreatment of sample cells, failure to meet CTC, and lack of specific antibodies, etc., to reduce Effects of light scattering, improved signal-to-background ratio, and large liquid flux

Active Publication Date: 2014-07-30
HUNAN UNIV
View PDF8 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, problems such as expensive analytical instruments, pretreatment of sample cells and long analysis time, and the lack of specific antibodies make these methods unable to meet the analysis requirements of CTC for convenience, rapidity, high specificity and high sensitivity.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Device and method for capturing specificity of circulating cancer cells in peripheral blood
  • Device and method for capturing specificity of circulating cancer cells in peripheral blood

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Such as figure 1 with figure 2 As shown, the device for cell-specific capture includes a syringe 1, a square capillary 3 communicated with the syringe 1 through a Teflon capillary 2; the inner wall of the square capillary 3 is adsorbed with avidin 6 and biotin-aptamer Complex 7.

Embodiment 2

[0036] Example 2: Specific capture method of circulating liver cancer cells in peripheral blood

[0037] (1) Synthesis of DNA sequence L1

[0038] Nucleic acid aptamer probe L1 (the italic part is the nucleic acid sequence that recognizes liver cancer cells, and the 3' end is modified with biotin):

[0039] 5'- AGTCCATTTTATTCCTGAATATTTGTTAACCTCATGGAC TTTTTTTTTT-3'-biotin

[0040]The DNA sequence L1 used to capture liver cancer cells was synthesized using an ABI3400 DNA / RNA synthesizer. Synthetic starting materials were purchased from Glen Research (Sterling, VA). DNA purification was achieved by ProStar HPLC (Varian). DNA concentration was determined by Cary Bio-300 UV-visible spectrometer (Varian).

[0041] (2) Immobilization of DNA sequence L1 on the capture device

[0042] Wash and activate the square capillary with 50 uL 1M NaOH; wash 5 times with 50 uL deionized water, then introduce 50 uL D-PBS containing 5 mg / mL avidin into the treated square capillary with a s...

Embodiment 3

[0048] Example 3: Specific capture method for circulating small cell lung cancer cells (SCLC) in peripheral blood

[0049] (1) Synthesis of DNA sequence L2

[0050] Nucleic acid aptamer probe L2 (the italic part is the nucleic acid sequence that recognizes small lung cancer cells, and the 3' end is modified with biotin):

[0051] 5'- GTGGATTGTTGTGTTCTGTTGGTTTTTGTGTTGTG TTTTTTTTTT-3'-biotin;

[0052] The DNA sequence L2 used to capture small lung cancer cells was synthesized using an ABI3400 DNA / RNA synthesizer. Synthetic starting materials were purchased from Glen Research (Sterling, VA). DNA purification was achieved by ProStar HPLC (Varian). DNA concentration was determined by Cary Bio-300 UV-visible spectrometer (Varian).

[0053] (2) Immobilization of DNA sequence L2 on the capture device

[0054] Wash and activate the square capillary with 50 uL 1M NaOH; wash 5 times with 50 uL deionized water, then introduce 50 uL D-PBS containing 5 mg / mL avidin into the treated...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a highly selective, highly sensitive, and universal cell-specific capture device and method. The nucleic acid aptamer of the invention is immobilized at one time, which can achieve high selectivity and high specificity for target cancer cells Capturing and providing a simple and easy elution method. The capture method of the present invention does not require complicated surface modification process, is low in cost, takes less time, is simple to operate, and has extremely wide application prospects.

Description

technical field [0001] The invention relates to a cell-specific capture device and method, in particular to a device and method for capturing circulating liver cancer cells in peripheral blood by cell affinity chromatography based on square capillary channels and nucleic acid aptamers. Background technique [0002] Malignant tumor is a major disease that endangers human health. The main cause of death is the transfer of invasive tumor cells to other tissues and organs. The current theory of tumor metastasis holds that tumor cells need to detach from the primary lesion and enter the blood or lymphatic circulation before they can form metastases in distant places. At the same time, studies have shown that the number of circulating tumor cells is closely related to prognosis. Therefore, the detection and analysis of circulating tumor cells (circulating tumor cells, CTCs) in peripheral blood is helpful for early diagnosis of tumors, postoperative monitoring, and efficacy evalua...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12M1/00C12N5/09
CPCC12M33/04
Inventor谭蔚泓蒋健晖陈卓吕一帆
OwnerHUNAN UNIV