Neutral lipase LIPG with wide temperature adaptability, gene and application thereof
A neutral lipase and lipase technology, applied in the field of genetic engineering, to achieve the effect of wide temperature adaptability and high temperature resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] Embodiment 1, cloning and expression of the lipase coding gene LipG of Geobacillus thermophilia
[0055] The thermophilic Geobacillus sp.B2 was derived from the sediment samples of artificial fish ponds in Jiaxing, Zhejiang. Using the genomic DNA of Geobacillus sp.B2 strain as a template, use the primers at both ends of the designed lipase, Lipase-f: ATGAGACGCGGTATTGTAAGCAC;
[0056] Lipase-r: TCATTGTTTGTCCTCCTCCGTC, PCR amplification, after sequencing analysis, finally get a complete lipase gene, LipG. The lipase gene uses ATG as the start codon, consists of 795 bases, encodes 264 amino acids and a stop codon TGA.
[0057] According to the sequence design of the gene, the expression primers for amplifying the mature protein sequence of the phytase gene: LipG-mF and LipG-mR (5'-CG GAATTC ATGAGACGCGGTATTGTAAGCAC-3′,5′-ATTT GCGGCCGC TCATTGTTTGTCCTCCTCCGTC-3′), and introduce restriction site EcoRI at the end of primer LipG-mF, introduce NotI at the end of primer LipG-...
Embodiment 2
[0059] Embodiment 2, the activity analysis method of lipase
[0060] Measuring principle: lipase hydrolyzes the substrate pNPP under certain temperature and pH conditions to generate yellow pNP. Within a certain concentration range, there is a linear relationship between the amount of generated pNP and the absorbance value at 410nm of the reaction solution. Based on this, the lipase activity can be calculated by measuring the 410nm absorbance value of the reaction solution.
[0061] Determination steps: substrate solution A: 90 mg p-nitrophenyl palmitate (pNPP) dissolved in 30 mL isopropanol; buffer solution B: 50 mmol / LTris-c1 (pH8.0). Take 2 test tubes, namely the control tube and the sample tube. Add 1.8mL of solution B and 0.1ml of substrate solution A to each of the two test tubes, incubate in a water bath at 37°C for 5 minutes, then add 0.1mL of inactivated enzyme solution to the control tube, add 0.1mL of enzyme solution to the sample tube, and mix immediately. Timed...
Embodiment 3
[0063] The purification of embodiment 3 recombinant phytase
[0064] The obtained positive clones were cultured in shake flasks according to the conventional method, and after being induced by IPTG, the bacterial cells were collected, and the cells were disrupted by ultrasonic waves. The supernatant of the cell disruption liquid was centrifuged, and the target protein was purified by nickel column affinity chromatography. Add 1mL of NTA column matrix to the empty column according to the packing instructions of NEB, and prepare the following pH 7.6 buffer:
[0065] 1) NTA-0, 20mmol / L Tris-HCl; 0.5mol / L NaCl; 10% (w / v) glycerol;
[0066] 2) NTA-20, 20mmol / L Tris-HCl; 20mmol / L imidazole; 0.5mol / L NaCl; 10% (w / v) glycerin;
[0067] 3) NTA-40, 20mmol / L Tris-HCl; 40mmol / L imidazole; 0.5mol / L NaCl; 10% (w / v) glycerol;
[0068] 4) NTA-60, 20mmol / L Tris-HCl; 60mmol / L imidazole; 0.5mol / L NaCl; 10% (w / v) glycerol;
[0069] 5) NTA-80, 20mmol / L Tris-HCl; 80mmol / L imidazole; 0.5mol / L Na...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap