Check patentability & draft patents in minutes with Patsnap Eureka AI!

Neutral lipase LIPG with wide temperature adaptability, gene and application thereof

A neutral lipase and lipase technology, applied in the field of genetic engineering, to achieve the effect of wide temperature adaptability and high temperature resistance

Inactive Publication Date: 2012-10-17
WUHAN SUNHY BIOLOGICAL
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

And up to now, hardly have the report of high enzymatic activity lipase under low temperature and neutral environment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Neutral lipase LIPG with wide temperature adaptability, gene and application thereof
  • Neutral lipase LIPG with wide temperature adaptability, gene and application thereof
  • Neutral lipase LIPG with wide temperature adaptability, gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Embodiment 1, cloning and expression of the lipase coding gene LipG of Geobacillus thermophilia

[0055] The thermophilic Geobacillus sp.B2 was derived from the sediment samples of artificial fish ponds in Jiaxing, Zhejiang. Using the genomic DNA of Geobacillus sp.B2 strain as a template, use the primers at both ends of the designed lipase, Lipase-f: ATGAGACGCGGTATTGTAAGCAC;

[0056] Lipase-r: TCATTGTTTGTCCTCCTCCGTC, PCR amplification, after sequencing analysis, finally get a complete lipase gene, LipG. The lipase gene uses ATG as the start codon, consists of 795 bases, encodes 264 amino acids and a stop codon TGA.

[0057] According to the sequence design of the gene, the expression primers for amplifying the mature protein sequence of the phytase gene: LipG-mF and LipG-mR (5'-CG GAATTC ATGAGACGCGGTATTGTAAGCAC-3′,5′-ATTT GCGGCCGC TCATTGTTTGTCCTCCTCCGTC-3′), and introduce restriction site EcoRI at the end of primer LipG-mF, introduce NotI at the end of primer LipG-...

Embodiment 2

[0059] Embodiment 2, the activity analysis method of lipase

[0060] Measuring principle: lipase hydrolyzes the substrate pNPP under certain temperature and pH conditions to generate yellow pNP. Within a certain concentration range, there is a linear relationship between the amount of generated pNP and the absorbance value at 410nm of the reaction solution. Based on this, the lipase activity can be calculated by measuring the 410nm absorbance value of the reaction solution.

[0061] Determination steps: substrate solution A: 90 mg p-nitrophenyl palmitate (pNPP) dissolved in 30 mL isopropanol; buffer solution B: 50 mmol / LTris-c1 (pH8.0). Take 2 test tubes, namely the control tube and the sample tube. Add 1.8mL of solution B and 0.1ml of substrate solution A to each of the two test tubes, incubate in a water bath at 37°C for 5 minutes, then add 0.1mL of inactivated enzyme solution to the control tube, add 0.1mL of enzyme solution to the sample tube, and mix immediately. Timed...

Embodiment 3

[0063] The purification of embodiment 3 recombinant phytase

[0064] The obtained positive clones were cultured in shake flasks according to the conventional method, and after being induced by IPTG, the bacterial cells were collected, and the cells were disrupted by ultrasonic waves. The supernatant of the cell disruption liquid was centrifuged, and the target protein was purified by nickel column affinity chromatography. Add 1mL of NTA column matrix to the empty column according to the packing instructions of NEB, and prepare the following pH 7.6 buffer:

[0065] 1) NTA-0, 20mmol / L Tris-HCl; 0.5mol / L NaCl; 10% (w / v) glycerol;

[0066] 2) NTA-20, 20mmol / L Tris-HCl; 20mmol / L imidazole; 0.5mol / L NaCl; 10% (w / v) glycerin;

[0067] 3) NTA-40, 20mmol / L Tris-HCl; 40mmol / L imidazole; 0.5mol / L NaCl; 10% (w / v) glycerol;

[0068] 4) NTA-60, 20mmol / L Tris-HCl; 60mmol / L imidazole; 0.5mol / L NaCl; 10% (w / v) glycerol;

[0069] 5) NTA-80, 20mmol / L Tris-HCl; 80mmol / L imidazole; 0.5mol / L Na...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the gene engineering field, specifically to neutral lipase LIPG with wide temperature adaptability, a gene and an application thereof. The invention provides the neutral lipase LIPG with wide temperature adaptability and its amino acid sequence as shown in SEQ ID NO.1. According to the neutral lipase obtained in the invention, it has high enzyme activity within the pH range of 6.5-8.5, has high enzyme activity within the temperature range of 25-80 DEG C with the optimum temperature being 65 DEG C, and still has about 60% of lipase activity at the temperature of 30 DEG C. Simultaneously, the lipase also has good thermal stability and still has 90% of residual enzyme activity after processed at 90 DEG C for half an hour. Therefore, the lipase can effectively withstand high temperature of feed granules. These properties make the lipase applicable in freshwater fish feeds.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a neutral lipase LIPG with wide temperature adaptability, its gene and application. Background technique [0002] The role of fat in livestock and poultry is mainly to oxidize and supply energy. The energy it contains is 2.25 times that of carbohydrates, which can meet the requirements of animals for higher energy concentration. Fat is a solvent for fat-soluble vitamins and certain hormones, which promotes the absorption and utilization of these substances, and at the same time provides essential unsaturated fatty acids for livestock and poultry to ensure the healthy growth of livestock and poultry; adding fat can also reduce dust in the process of feed processing , improve the appearance of the feed, and under high temperature conditions, it is also beneficial to increase the energy intake, reduce the body heat consumption of livestock and poultry, and slow down the heat stres...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/20C12N15/55C12N15/63C12N1/21C12N1/19A23K1/165C12R1/19C12R1/07C12R1/225
Inventor 詹志春张菁
Owner WUHAN SUNHY BIOLOGICAL
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More