Pseudo attP site in swine genome and application thereof
A porcine genome and site technology, applied in the fields of biotechnology and biomedical engineering, can solve the problems of widening application scope, low net performance, and increasing difficulty in operability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 Construction of the green fluorescent protein expression vector pEGFP-C1-attB containing the attB site
[0032] (1) Sources of main reagents and materials
[0033] pBCP + The vector was purchased from Addgene, and pEGFP-C1-EGFP was purchased from Clontech. Lamda DNA marker and Asel restriction endonuclease were purchased from Fermentas. High-fidelity DNA polymerase KOD Plus and its matching buffer (10×buffer), dNTP, MgSO 4 All were purchased from Toyobo Biotechnology Co., Ltd. The recombinant vector was carried out in accordance with the instructions of the small-scale ultra-pure plasmid extraction kit provided by Beijing Tiangen Biotechnology Co., Ltd. DNA tapping gel recovery kit was purchased from Qiagen. Sequencing was entrusted to Shenzhen Huada Gene Co., Ltd. to complete.
[0034] The primers for amplifying the attB sequence are AttB-F:gtc attaat CGCCATTCAGGCTGCGCA (SEQ ID No. 2), AttB-R: gtc attaat CTCGGCCTCGACTCTAG (SEQ ID No. 3). The underl...
Embodiment 2
[0064] Example 2 Screening of pig transgenic cell lines integrating pEGFP-C1-attB
[0065] (1) Sources of main reagents and materials
[0066] The porcine kidney PK15 cell line was purchased from ATCC. Fugene HD transfection reagent was purchased from Roche. The фC31 integrase expression vector pCMV-фC31 was purchased from Addgene. The preparation of endotoxin-free plasmids was carried out according to the instructions of the small-scale ultra-pure plasmid extraction kit provided by Beijing Tiangen Biotechnology Co., Ltd. G418 antibiotic was purchased from Sigma. DMEM, DPBS, fetal bovine serum, Opti-MEM, DMSO were purchased from Invitrogen.
[0067] (2) Operation steps
[0068] - cell plating
[0069] After the PK15 cells were digested with trypsin to form a single cell suspension, according to 10 4 Cells / well were plated in 24-well plates and grown overnight. Before transfection, the cells were washed twice with DPBS pre-warmed to 37°C, and then replaced with fresh co...
Embodiment 3
[0077] Example 3 Isolation and positioning analysis of pseudo attP sites in pig genome
[0078] (1) Sources of main reagents and materials
[0079] Genome walking kit and pMD18-T TA cloning vector were purchased from Takara Company. DNA tapping gel recovery kit was purchased from Qiagen. Mammalian Genomic DNA Extraction Kit was purchased from Kangwei Century. Sequencing was entrusted to Shenzhen Huada Gene Co., Ltd. to complete.
[0080] The nested specific primers of pEGFP-C1-attB are: SP1, GCTTATAGATACCGTAGACAT (SEQ ID No.4); SP2, TCCCGTGCTCACCGTGACC (SEQ ID No.5); SP3, ATCAACTACCGCCACCTCG (SEQ ID No.6). TA clone positive recombinant identification primers: M13R, CAG GAA ACA GCT ATG ACC ATG (SEQ ID No.7); M13F, ACG TTG TAA AAC GAC GGC GAC (SEQ ID No.8). The primers were synthesized by Shanghai Yingjun Biotechnology Co., Ltd., packaged, transported, and stored in the form of dry powder. The primers were diluted with TE buffer (pH=8.0) to a solution of 10 μmol / L, and stor...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap