Unlock instant, AI-driven research and patent intelligence for your innovation.

Pseudo attP site in swine genome and application thereof

A porcine genome and site technology, applied in the fields of biotechnology and biomedical engineering, can solve the problems of widening application scope, low net performance, and increasing difficulty in operability

Inactive Publication Date: 2012-11-28
INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The two belong to the tyrosine family of site-specific recombinases, have similar mechanisms of action, and both mediate reversible recombination reactions, which determines that the net efficiency of the two in mediating the site-specific integration of foreign genes is still low; and in actual use It is also necessary to "preset" its recognition sequence at a specific site in the genome, which increases the difficulty from the perspective of operability (Nern A, et al. Multiple new site-specific recombinases for use in manipulating animal genomes.Proc Natl Acad Sci U S A,2011,108(34):14198-14203.)
The above query shows that the research on фC31 integrase is gradually attracting attention, but its application scope needs to be broadened

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pseudo attP site in swine genome and application thereof
  • Pseudo attP site in swine genome and application thereof
  • Pseudo attP site in swine genome and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Construction of the green fluorescent protein expression vector pEGFP-C1-attB containing the attB site

[0032] (1) Sources of main reagents and materials

[0033] pBCP + The vector was purchased from Addgene, and pEGFP-C1-EGFP was purchased from Clontech. Lamda DNA marker and Asel restriction endonuclease were purchased from Fermentas. High-fidelity DNA polymerase KOD Plus and its matching buffer (10×buffer), dNTP, MgSO 4 All were purchased from Toyobo Biotechnology Co., Ltd. The recombinant vector was carried out in accordance with the instructions of the small-scale ultra-pure plasmid extraction kit provided by Beijing Tiangen Biotechnology Co., Ltd. DNA tapping gel recovery kit was purchased from Qiagen. Sequencing was entrusted to Shenzhen Huada Gene Co., Ltd. to complete.

[0034] The primers for amplifying the attB sequence are AttB-F:gtc attaat CGCCATTCAGGCTGCGCA (SEQ ID No. 2), AttB-R: gtc attaat CTCGGCCTCGACTCTAG (SEQ ID No. 3). The underl...

Embodiment 2

[0064] Example 2 Screening of pig transgenic cell lines integrating pEGFP-C1-attB

[0065] (1) Sources of main reagents and materials

[0066] The porcine kidney PK15 cell line was purchased from ATCC. Fugene HD transfection reagent was purchased from Roche. The фC31 integrase expression vector pCMV-фC31 was purchased from Addgene. The preparation of endotoxin-free plasmids was carried out according to the instructions of the small-scale ultra-pure plasmid extraction kit provided by Beijing Tiangen Biotechnology Co., Ltd. G418 antibiotic was purchased from Sigma. DMEM, DPBS, fetal bovine serum, Opti-MEM, DMSO were purchased from Invitrogen.

[0067] (2) Operation steps

[0068] - cell plating

[0069] After the PK15 cells were digested with trypsin to form a single cell suspension, according to 10 4 Cells / well were plated in 24-well plates and grown overnight. Before transfection, the cells were washed twice with DPBS pre-warmed to 37°C, and then replaced with fresh co...

Embodiment 3

[0077] Example 3 Isolation and positioning analysis of pseudo attP sites in pig genome

[0078] (1) Sources of main reagents and materials

[0079] Genome walking kit and pMD18-T TA cloning vector were purchased from Takara Company. DNA tapping gel recovery kit was purchased from Qiagen. Mammalian Genomic DNA Extraction Kit was purchased from Kangwei Century. Sequencing was entrusted to Shenzhen Huada Gene Co., Ltd. to complete.

[0080] The nested specific primers of pEGFP-C1-attB are: SP1, GCTTATAGATACCGTAGACAT (SEQ ID No.4); SP2, TCCCGTGCTCACCGTGACC (SEQ ID No.5); SP3, ATCAACTACCGCCACCTCG (SEQ ID No.6). TA clone positive recombinant identification primers: M13R, CAG GAA ACA GCT ATG ACC ATG (SEQ ID No.7); M13F, ACG TTG TAA AAC GAC GGC GAC (SEQ ID No.8). The primers were synthesized by Shanghai Yingjun Biotechnology Co., Ltd., packaged, transported, and stored in the form of dry powder. The primers were diluted with TE buffer (pH=8.0) to a solution of 10 μmol / L, and stor...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a pseudo attP site in the swine genome and applications thereof, belonging to the technical field of biotechnology and biomedical engineering. According to the invention, a pseudo attP site is isolated from the swine genome, and the pseudo attP site has a sequence similarity of 40% with the wild type attP site and has the characteristic of palindromic sequence. The pseudo attP site can be recognized by Streptomycete bacteriophage phi C 31 intergrase, and thereby exogenous genes having attP site can be mediated to integrate in the site in relatively high efficiency. According to protein content tests, the expression level of EGFP gene maintained by the pseudo attP site is 50 times that by the genome without exogenous genes. The invention provides a new technical scheme for targeted integration and high efficiency expression for swine transgene, and a new strategy for the research of swine functional genome, so the invention has important science value and broad application prospect.

Description

technical field [0001] The invention belongs to the field of biotechnology and biomedical engineering, and in particular relates to a pseudo attP site of pig genome and its application. Background technique [0002] Using various molecular means to integrate exogenous genes into the pig genome and endow pigs with specific traits is an effective way to promote the use of pigs in basic science, agriculture and medical research. From the point of view of site specificity, the means of exogenous gene integration can be divided into two types: non-site-specific and site-specific. Non-site-specific types include naked DNA microinjection, virus-mediated, transposon, etc. Although virus-mediated and transposons have greatly improved the gene transfer efficiency, due to the low stringency of the recognition site, the integration specificity has not been substantially improved, so it is difficult to strictly control the integration site. The expression of is also difficult to predic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12N15/85C12N5/10
Inventor 毕延震郑新民乔宪凤刘西梅马卓张龙周荆荣华文君李莉肖红卫张立苹华再东魏庆信
Owner INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More