Check patentability & draft patents in minutes with Patsnap Eureka AI!

Carrier suitable for cell transformation, recombinant cell and application thereof

A technology for transforming cells and recombining cells, applied in recombinant DNA technology, using vectors to introduce foreign genetic material, cells modified by introducing foreign genetic material, etc., can solve the problem of insensitivity to dioxin substances, high false positives, and British compounds need to be improved and other issues

Inactive Publication Date: 2013-01-02
SHENZHEN HUADA GENE INST +1
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this method still has high false positives, and is not sensitive to low-concentration dioxin substances, and the detection cost is high and time-consuming
[0005] Therefore, the current detection methods for dioxin-like compounds still need to be improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Carrier suitable for cell transformation, recombinant cell and application thereof
  • Carrier suitable for cell transformation, recombinant cell and application thereof
  • Carrier suitable for cell transformation, recombinant cell and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0086] Example 1 Construction of recombinant cell lines Hepa1-6DEGFP and Hepa1-6DLUC containing dioxin response element DRE and reporter gene

[0087] 1. Construction of recombinant vectors pDRE-CMVmin-EGFP and pDRE-CMVmin-luc+ containing dioxin response element DRE and reporter gene

[0088] Studies have shown that the upstream of mouse cytochrome P450 gene CYP1A1 has six dioxin response elements labeled A-F, which can bind to the dioxin-aromatic hydrocarbon receptor complex to initiate the expression of CYP1A1, of which B, D, E, F High binding and activation efficiency (Amy Lusska et al. Protein-DNA Interactions at a Dioxin-responsive Enhancer. 1993. The Journal of Biological Chemistry.). Synthesize three tandem DRE sequences and the basic element CMVmin of the early promoter of cytomegalovirus (referred to as 3DRE+CMVmin in this article for convenience of description) by gene synthesis method (Invitrogen Company). Add BglII and HindIII restriction endonuclease sites to the...

Embodiment 2

[0104] Example 2 Construction of high-sensitivity recombinant cell lines Hepa1-6ADEGFP and Hepa1-6ADLUC with ahr gene overexpression

[0105] 1. Aryl hydrocarbon receptor gene ahr overexpression vector construction

[0106] The coding sequence of the mouse aryl hydrocarbon receptor gene ahr was searched through NCBI, and its sequence number is NM_013464.4, which has the nucleotide sequence shown in SEQ ID NO:9. Primers were designed according to the sequence, and the primer sequences are shown in the table below:

[0107] Primer name

Primer sequence (5'-3', SEQ ID NO: )

P1

TAG ACCGGT ATGAGCAGCGGCGCCAACATC(10)

P2

CCG CTCGAG TCAACTCTGCACCTTGCTT(11)

[0108] Among them, P1 and P2 are used to amplify the ahr gene fragment. For the convenience of subsequent operations, P1 and P2 respectively contain AgeI and XhoI restriction endonuclease sites, which are underlined in the table.

[0109] The mouse liver was taken, and the total ...

Embodiment 3

[0139] Example 3 Comparison of Responses of Recombinant Cell Lines Hepa1-6DEGFP and Hepa1-6ADEGFP to Dioxin Standards (2,3,7,8-TCDD)

[0140] Inoculate the recombinant cell line in a 48-well cell plate, add 200 microliters of DMEM culture solution containing 10% FBS to each well, and place the cell plate at 37°C, 5% CO 2 Cultivate in a constant temperature incubator for 24 hours;

[0141] Dilute the dioxin standard 2,3,7,8-TCDD with DMSO, so that the final concentration of each well of the cell plate is 0.1pg / ml, each experimental group is repeated three times, and the control group uses the same volume of DMSO-treated cells;

[0142] Dioxin standards were mixed with recombinant cells and incubated for 24 hours. The green fluorescence was observed under a fluorescent microscope and photographed. The results are shown in Figure 5 middle. Such as Figure 5 As shown, two recombinant cells of Hepa1-6DEGFP and Hepa1-6ADEGFP emitted green fluorescence after being induced by dio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a carrier suitable for cell transformation, a recombinant cell and an application thereof, wherein a group of carriers suitable for cell transformation comprise a first carrier and a second carrier. The first carrier comprises a first nucleic acid sequence; the first nucleic acid sequence comprises a sequence coding report protein; and the report protein has detectable activity; the first nucleic acid sequence also comprises a dioxin response region which comprises a dioxin response element; and the dioxin response region is operably connected with the first nucleic acid sequence. The second carrier comprises a second nucleic acid sequence, and the second nucleic acid sequence comprises a sequence coding an aromatic hydrocarbon receptor. The carrier suitable for cell transformation and the recombinant cell of the invention are applicable to detection of dioxin compounds.

Description

technical field [0001] The present invention relates to the field of biotechnology, in particular to vectors suitable for transforming cells, recombinant cells and applications thereof. More specifically, the present invention provides a set of vectors suitable for transforming cells, two vectors suitable for transforming cells, a recombinant cell and its preparation method, a method for detecting dioxin in a sample, a method for A kit for detecting dioxin compounds in a sample, a system for detecting dioxin compounds in a sample, and a method for screening agents having activity in degrading dioxin compounds. Background technique [0002] Dioxin-like substances include polychlorinated dibenzo-dioxins (PCDDs), polychlorinated dibenzo-furans (polychlorinated dibenzo-furans, PCDFs) and coplanar polychlorinated biphenyls (coplanar polychlorinated biphenyls). -planar polychlorinated biphenyls, Co-PCBs) and other general term for a large class of compounds (Larsen et al, 2000), ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N5/10C12Q1/02G01N21/31G01N21/64G01N21/76G01N33/68
Inventor 徐俊光李勇魏霞赵云战丽萍张立通王俊汪建
Owner SHENZHEN HUADA GENE INST
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More