Unlock instant, AI-driven research and patent intelligence for your innovation.

High-throughput sequencing method for methylated DNA and use thereof

A methylation and DNA library technology, applied in the fields of genomics and biology, can solve the problems of high sequence, limited amount of DNA captured by exon capture chip, and experimental influence.

Active Publication Date: 2014-04-09
INST OF PSYCHOLOGY CHINESE ACADEMY OF SCI +1
View PDF5 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] Although this sequencing method solves the high-throughput problem of scanning DNA methylation profiles at the whole gene level, this method generates massive nucleotide sequences, which also brings new problems: first, the problem of massive data analysis
However, due to the limited amount of DNA captured by the exon capture chip, which has an impact on subsequent experiments, its ability to remove redundant methylated DNA is not enough to meet the sequencing analysis of methylated DNA at the genome level

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-throughput sequencing method for methylated DNA and use thereof
  • High-throughput sequencing method for methylated DNA and use thereof
  • High-throughput sequencing method for methylated DNA and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0167] In the embodiment, the adapters, qPCR detection primers and PCR amplification primers of DNA after sulfonation treatment are artificially synthesized sequences synthesized by Invitrogen; the COT1 DNA used is purchased from Invitrogen, and the qPCR detection uses SYBR and supporting reagents of AB Company; EcoP15I Enzymes were purchased from NEB Corporation. The principle of operation of the embodiment is as Figure 5 shown.

[0168] 1. Obtaining Genomic DNA

[0169] Take 10 ml of blood sample 1 (taken from volunteers), and use QIAamp DNA Blood Mini Kit (Qiagen) to extract sample DNA. The extracted DNA is numbered as YH-1, and 10 micrograms of the DNA sample is taken as the starting material, refer to figure 1 The library was constructed according to the procedure, and the IlluminaGA System Paired End library was constructed in this example.

[0170] 2. fragmented genomic DNA

[0171] The Covaris system (AB company) was used to fragment the DNA sample in the af...

Embodiment 2

[0239] The principle of embodiment 2 is as Figure 6 As shown, except that the following steps are different from Example 1, all steps are the same as Example 1, and replace Steps 5, 9 and 10 in Example 1 with the following steps 5, 9 and 10:

[0240] 5. Auxiliary connector connection

[0241] Take out the 2x Rapid ligation buffer and Alu Linker from the kit stored at -20°C, put them on ice to thaw and mix the 2x Rapid ligation buffer well. Prepare 100 μL ligation reaction system in a 1.5 mL centrifuge tube: 30 μL plus A recovery product, 50 μL 2x Rapid ligation buffer, 6 μL auxiliary adapter (50uM) (5’-CTGGGCACCGCTCATGCCACTCCGGC TAAG 5m CT, 5'-pG 5m CTTAGCCGGAGTGGCATGAGCGGTGCCCAG), 10 μL T4 DNA ligase, and 4 μL ultrapure water. After incubating at 20°C for 15 minutes, ZYMO DNA Clean & Concentrator PTMP-5 was used to recover and purify the DNA connected with the auxiliary linker, and the product was dissolved in 40 μL of TE.

[0242] 9. PCR amplification of DNA after ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a high-throughput sequencing method for methylated DNA, and use thereof. Particularly, the present invention provides a high-throughput sequencing method for methylated DNA, which combines methylated DNA immunoprecipitation, removal of repetitive sequences, and bisulfite treatment. The site of sequencing library will be decreased, and the cost will be reduced by using the method disclosed in the present invention.

Description

technical field [0001] The present invention relates to the fields of genomics and biotechnology, and specifically relates to the combination of methylated DNA co-immunoprecipitation, repetitive sequence removal and bisulfite treatment high-throughput sequencing technology to perform cytosine 5' carbon atoms in genomic functional regions A method for performing accurate sequencing of the methylation status of the methylated DNA; furthermore, a device capable of performing such sequencing is provided, thereby reducing the cost of sequencing, reducing the amount of information processing, and performing high-throughput sequencing of methylated DNA more efficiently. Background technique [0002] The relationship between DNA methylation and gene regulation or disease [0003] In the genome of higher eukaryotes, DNA methylation is to change the spatial structure of the modified DNA without changing the type and quantity of DNA bases, resulting in gene silencing or overexpression,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6804C12Q1/6874C12Q1/6806C12Q1/6869C12N15/1093C12Q2521/331C12Q2523/125C12Q2525/191
Inventor 王燕叶明芝韩旭张秀清孙中生
Owner INST OF PSYCHOLOGY CHINESE ACADEMY OF SCI