High-throughput sequencing method for methylated DNA and use thereof
A methylation and DNA library technology, applied in the fields of genomics and biology, can solve the problems of high sequence, limited amount of DNA captured by exon capture chip, and experimental influence.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0167] In the embodiment, the adapters, qPCR detection primers and PCR amplification primers of DNA after sulfonation treatment are artificially synthesized sequences synthesized by Invitrogen; the COT1 DNA used is purchased from Invitrogen, and the qPCR detection uses SYBR and supporting reagents of AB Company; EcoP15I Enzymes were purchased from NEB Corporation. The principle of operation of the embodiment is as Figure 5 shown.
[0168] 1. Obtaining Genomic DNA
[0169] Take 10 ml of blood sample 1 (taken from volunteers), and use QIAamp DNA Blood Mini Kit (Qiagen) to extract sample DNA. The extracted DNA is numbered as YH-1, and 10 micrograms of the DNA sample is taken as the starting material, refer to figure 1 The library was constructed according to the procedure, and the IlluminaGA System Paired End library was constructed in this example.
[0170] 2. fragmented genomic DNA
[0171] The Covaris system (AB company) was used to fragment the DNA sample in the af...
Embodiment 2
[0239] The principle of embodiment 2 is as Figure 6 As shown, except that the following steps are different from Example 1, all steps are the same as Example 1, and replace Steps 5, 9 and 10 in Example 1 with the following steps 5, 9 and 10:
[0240] 5. Auxiliary connector connection
[0241] Take out the 2x Rapid ligation buffer and Alu Linker from the kit stored at -20°C, put them on ice to thaw and mix the 2x Rapid ligation buffer well. Prepare 100 μL ligation reaction system in a 1.5 mL centrifuge tube: 30 μL plus A recovery product, 50 μL 2x Rapid ligation buffer, 6 μL auxiliary adapter (50uM) (5’-CTGGGCACCGCTCATGCCACTCCGGC TAAG 5m CT, 5'-pG 5m CTTAGCCGGAGTGGCATGAGCGGTGCCCAG), 10 μL T4 DNA ligase, and 4 μL ultrapure water. After incubating at 20°C for 15 minutes, ZYMO DNA Clean & Concentrator PTMP-5 was used to recover and purify the DNA connected with the auxiliary linker, and the product was dissolved in 40 μL of TE.
[0242] 9. PCR amplification of DNA after ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com