Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene for controlling plant height and neck length of spike of rice and application

A gene and rice technology, applied in the field of plant genetic engineering, can solve the problems of increasing the cost of rice seed production, affecting the quality of seed production, and affecting the effect, and achieve the effects of improving panicle neck length, improving seed quality, and protecting the environment

Inactive Publication Date: 2013-04-03
HUAZHONG AGRI UNIV
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] The rice sterile line also has the defect of "ear wrapping". In order to solve the "ear wrapping" phenomenon in the production of hybrid rice, 920 (also known as gibberellin) is often used too much, thus increasing the cost of rice seed production and affecting the production of rice. This kind of quality leads to environmental pollution, and the effect is easily affected by external factors (sprayer's technology, application period and weather conditions at the time of application)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene for controlling plant height and neck length of spike of rice and application
  • Gene for controlling plant height and neck length of spike of rice and application
  • Gene for controlling plant height and neck length of spike of rice and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1 Construction of amiRNA expression vector

[0054] Warthmann et al. (2008) reported that the use of maize Ubiquitin promoter to constitutively express a specific amiRNA sequence (TTGAGAACTATGCACGGGCGC) can specifically inhibit the expression of the rice Eui1 gene (Os05g40384), and improve the internodes of rice, especially the top node. significantly increased the plant height and panicle neck length of rice. In the present invention, we used the plasmid pNW55 (provided by Professor Detlef Weigel of the Max Planck Institute for Biological Development in Germany) as a template to obtain the Eui1 gene in rice according to the overlap extension PCR (overlap extension PCR) method described by Warthmann et al. (2008). The amiRNA precursor gene (named eui-amiRNA) was cloned into the T vector pGEM-T (Promega, USA), and then verified by sequencing. The amiRNA precursor gene was excised from the T vector with restriction endonucleases BamH I and Kpn I, and cloned into ...

Embodiment 2

[0057] Embodiment 2 Construction of artificial target mimic expression vector

[0058] Plasmid MT375 (provided by Professor Detlef Weigel of the Max Planck Institute for Biological Development in Germany) carries the rice natural target mimic gene OsIPS1 (GenBank: AY568759.1) ( Figure 4 ), the mRNA transcribed by OsIPS1 has a 24nt sequence complementary to rice miRNA osa-MIR399 as a template. The overlap extension PCR method (Franco-Zorrilla, et al.2007) was used to replace the sequence complementary to osa-MIR399 on the natural OsIPS1 with the sequence complementary to eui-amiRNA to form an artificial target mimic gene (see sequence table SEQ ID NO: 3 and SEQ ID NO: 5). The design of the Target mimic gene refers to the mechanism of action of the target mimicry found in plants by Franco-Zorrilla et al. (2007). We designed two target mimic genes (respectively named MIMa (see SEQ ID NO: 3 in the sequence listing) and MIMb (see SEQ ID NO: 5 in the sequence listing)) with sligh...

Embodiment 3

[0064] The genetic transformation of embodiment 3 rice

[0065] Since the rice sterile line could not receive the transgenic seeds, the expression vector pEUI-amiRNA was first transformed into the rice maintainer line ZS97B through the Agrobacterium-mediated genetic transformation method to obtain the transgenic rice family eZS97B. Then, the eui-amiRNA in eZS97B was introduced into the corresponding sterile line ZS97A by hybridization to obtain the transgenic sterile line eZS97A (the deposit number of China Center for Type Culture Collection is CCTCC NO P201111). The pC1300-MIMa and pC1300-MIMb were introduced into the rice restorer line Minghui 63 (MH63) by the Agrobacterium-mediated method, and the transgenic material obtained was named MH63-MIMb (the deposit number of the China Center for Type Culture Collection is CCTCC NO P201113) . For the transgenic method, refer to Lin and Zhang (2005).

[0066] The steps of Agrobacterium-mediated genetic transformation are as follow...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a gene for controlling the plant height and neck length of spike of rice and application, belonging to the technical field of plant genetic engineering and relating to the technical fields of plant transgenic technology and rice molecular breeding. A target mimic gene MIMb which weakens the eui (elongated uppermost internode)-1 gene interference function of artificial microRNA is obtained by the plant gene cloning technology. The nucleotide sequence of the target mimic gene MIMb is shown in SEQ NO:5 in a sequence table. The rice material with plant height and neck length of spike recovered to the wild levels is obtained by hybridizing the rice materials eZS97A and MH63-MIMb with long necks of spike. The invention also discloses a preparation method and application of the gene.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering. Specifically, it involves using a two-factor system composed of an artificial microRNA (artificial microRNA, amiRNA) and an artificial target mimic gene to control the plant height and panicle neck length of a rice sterile line and its hybrids. The present invention uses amiRNA technology to specifically silence the expression of Eui1 (elongated uppermost internode 1) gene in the gibberellin (GA) synthetic metabolic pathway in the transgenic rice male sterile line. The product of the Eui1 gene can inactivate the biologically active gibberellin GA4. Inhibiting the expression of Eui1 can increase the content of endogenous GA4 in rice, thereby increasing its plant height and panicle neck length, and alleviating the ear wrapping characteristics of rice sterile lines. Target mimicry is a mechanism that naturally exists in plants to inhibit the action of specific miRNAs. The artifici...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12N15/113C12N15/63A01H5/00A01H1/02
Inventor 陈浩江山林拥军
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com