Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of Beauveria bassiana as-70 bacterial strain and its application

A technology of Beauveria bassiana and strains, applied in the application, fungi, biocides and other directions, can solve problems such as restricting the export of agricultural products, and achieve the effects of good development and application prospects, simple production process, and good insecticidal activity

Active Publication Date: 2014-10-22
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, the "green barrier" caused by chemical pesticide residues has seriously restricted the export of agricultural products in my country, and the traditional agricultural industry is also facing greater risks and challenges

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of Beauveria bassiana as-70 bacterial strain and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0013] Example 1: Classification of the marine-derived Beauveria felina AS-70 strain.

[0014] 1) Bacteria culture

[0015] According to the conventional culture method of microorganisms, a small amount of Beauveria felina AS-70 preserved in the agar-malt extract medium was picked, inoculated on the surface of the PDA plate, and cultured at 28°C for 7 days. Milky white conidiophores are formed.

[0016] 2) Preliminary identification of strains

[0017] According to the literature method (J. Nat.Prod.2006,69,1622.), the fungal ribosomal rDNA gene transcription spacer sequence (ITS1-5.8S-ITS2 full-length sequence) was cloned, sequenced, and compared with the known strains in the Genbank database Compared with the corresponding sequence information, its similarity with the strain Beauveria felina (Accession number: AY261369) is 99%. The sequence information is as follows:

[0018] CTCCTTTGTGACATACCTATCGTTGCTTCGGCGGGTCCGTCCCGGAGC TGGCAGTGCACGGCCAGCCCCGGAACCAGACGCCCGCCGAGGACCC ...

Embodiment 2

[0020] Fermentation of Beauveria felina AS-70 strain:

[0021] 1) Fermentation culture

[0022] Strain culture: According to the conventional culture method of microorganisms, pick a small amount of Beauveria felina AS-70 stored in agar-malt extract medium, inoculate it on the surface of PDA plate, and cultivate it at 28°C for 3 days as a large-scale fermentation culture strains, to be used.

[0023] Cut off the appropriate amount of bacteria on the surface of the above-mentioned PDA plate, inoculate it into a sterilized Erlenmeyer flask filled with rice culture medium, let it stand at room temperature for 30 days, and then adopt ethyl acetate to sterilize it for later use.

[0024] The rice culture medium is rice 100g / bottle, peptone 0.6g / bottle, and natural seawater 100mL / bottle.

[0025] 2) Separation and purification of fermentation products

[0026] The above-mentioned Beauveria bassiana was fermented and cultured on the rice medium, and the product was ultrasonically ...

Embodiment 3

[0027] Embodiment 3: insecticidal activity test

[0028] Artemia (brine shrimp), also known as saltwater Artemia, belongs to the phylum Arthropoda, Crustacea, Order Anocaria, Saltwater Artemia family, and the genus Artemia. As a model for insecticide screening, Artemia has been reported at home and abroad. Wang Zaiqiang et al. [Pesticides, 2011, 50(4): 261–263] used Artemia as a model organism to evaluate the killing effect of 14 common insecticides. Insecticidal activity, the results show that the method of screening compounds with insecticidal activity with Artemia is simple, and it is sensitive to a variety of insecticides with different mechanisms of action; Hu Zhiyu et al. Artemia is used as an indicator organism to quickly screen compounds with insecticidal activity in marine actinomycetes; Blizzard T.A. et al. Analogues of the element. In conclusion, as a model organism for the determination of insecticidal activity, Artemia has the advantages of a wide range of sourc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a microbial pesticide preparation, in particular to a beauveria felina AS-70 strain and an application thereof. The beauveria felina AS-70 was collected in the China General Microbiological Culture Collection Center (CGMCC) on September 29th, 2012, and the collection number is CGMCC NO. 6643. A fermentation product of the beauveria felina is used for preparing an agricultural insecticide. The strain is separated from bryozoan collected on Su'ao Island in Fujian, the ITS1-5.8S-ITS2 sequence of the strain is measured and compared with the information of the corresponding sequence of the known strain in a Genbank database, and the similarity between the strain and the beauveria felina (Accession number: AY261369) is 99 percent. The fermentation product of the strain can be used for preparing the agricultural insecticide, and has the characteristics of simple production process, short period, low product cost and the like.

Description

technical field [0001] The invention relates to a microbial pesticide preparation, in particular to a Beauveria bassiana AS-70 strain and application thereof. Background technique [0002] With the extensive use of chemical pesticides, the resistance of plant diseases and insect pests to them has become more and more obvious, which has also brought about problems such as environmental pollution, human and animal poisoning, and three causes (carcinogenic, teratogenic, and mutagenic). In recent years, the "green barrier" caused by chemical pesticide residues has seriously restricted the export of agricultural products in my country, and the traditional agricultural industry is also facing greater risks and challenges. Compared with traditional chemically synthesized pesticides, microbial-derived pesticides have the advantages of being safe to humans, animals and non-target organisms, good environmental compatibility, and less likely to develop resistance. [0003] Beauveria i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/14A01N63/04A01P7/04C12R1/645
Inventor 王斌贵杜丰玉
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI