A kind of Beauveria bassiana as-70 bacterial strain and its application
A technology of Beauveria bassiana and strains, applied in the application, fungi, biocides and other directions, can solve problems such as restricting the export of agricultural products, and achieve the effects of good development and application prospects, simple production process, and good insecticidal activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0013] Example 1: Classification of the marine-derived Beauveria felina AS-70 strain.
[0014] 1) Bacteria culture
[0015] According to the conventional culture method of microorganisms, a small amount of Beauveria felina AS-70 preserved in the agar-malt extract medium was picked, inoculated on the surface of the PDA plate, and cultured at 28°C for 7 days. Milky white conidiophores are formed.
[0016] 2) Preliminary identification of strains
[0017] According to the literature method (J. Nat.Prod.2006,69,1622.), the fungal ribosomal rDNA gene transcription spacer sequence (ITS1-5.8S-ITS2 full-length sequence) was cloned, sequenced, and compared with the known strains in the Genbank database Compared with the corresponding sequence information, its similarity with the strain Beauveria felina (Accession number: AY261369) is 99%. The sequence information is as follows:
[0018] CTCCTTTGTGACATACCTATCGTTGCTTCGGCGGGTCCGTCCCGGAGC TGGCAGTGCACGGCCAGCCCCGGAACCAGACGCCCGCCGAGGACCC ...
Embodiment 2
[0020] Fermentation of Beauveria felina AS-70 strain:
[0021] 1) Fermentation culture
[0022] Strain culture: According to the conventional culture method of microorganisms, pick a small amount of Beauveria felina AS-70 stored in agar-malt extract medium, inoculate it on the surface of PDA plate, and cultivate it at 28°C for 3 days as a large-scale fermentation culture strains, to be used.
[0023] Cut off the appropriate amount of bacteria on the surface of the above-mentioned PDA plate, inoculate it into a sterilized Erlenmeyer flask filled with rice culture medium, let it stand at room temperature for 30 days, and then adopt ethyl acetate to sterilize it for later use.
[0024] The rice culture medium is rice 100g / bottle, peptone 0.6g / bottle, and natural seawater 100mL / bottle.
[0025] 2) Separation and purification of fermentation products
[0026] The above-mentioned Beauveria bassiana was fermented and cultured on the rice medium, and the product was ultrasonically ...
Embodiment 3
[0027] Embodiment 3: insecticidal activity test
[0028] Artemia (brine shrimp), also known as saltwater Artemia, belongs to the phylum Arthropoda, Crustacea, Order Anocaria, Saltwater Artemia family, and the genus Artemia. As a model for insecticide screening, Artemia has been reported at home and abroad. Wang Zaiqiang et al. [Pesticides, 2011, 50(4): 261–263] used Artemia as a model organism to evaluate the killing effect of 14 common insecticides. Insecticidal activity, the results show that the method of screening compounds with insecticidal activity with Artemia is simple, and it is sensitive to a variety of insecticides with different mechanisms of action; Hu Zhiyu et al. Artemia is used as an indicator organism to quickly screen compounds with insecticidal activity in marine actinomycetes; Blizzard T.A. et al. Analogues of the element. In conclusion, as a model organism for the determination of insecticidal activity, Artemia has the advantages of a wide range of sourc...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 