16S rDNA based preparation method of bacteria nucleic acid fingerprint characteristic spectrums and application thereof

A fingerprint feature and bacterial nucleic acid technology, applied in the biological field, can solve the problems of easy introduction of errors, easy generation of sets of peaks in sequencing, and high cost.

Inactive Publication Date: 2013-04-24
向华
View PDF5 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The sequencing method is applied to clinical detection, and there are currently the following problems: (1) high cost; (2) time-consuming; (3) for mixed samples, sequencing is prone to overlapping peaks, which is difficult to effectively distinguish; (4) the full length of 16S rDNA is 1.5 More than kb, it generally needs to be sequenced twice and the results are spliced, which is easy to introduce errors in this process
[0013] As mentioned above, 16S rDNA is of great significance to the classification and identification of bacteria, but traditional sequencing and other methods are costly and time-consuming; for samples with mixed infections, the sequencing method will obtain mixed sequence peaks, which is difficult to effectively distinguish. And the use of mass spectrometry for analyte analysis requires selection of suitable analytes and optimization of mass spectrometry parameters. Therefore, new bacterial classification techniques (such as mass spectrometry) are currently needed to achieve fast, accurate, cheap and convenient classification results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 16S rDNA based preparation method of bacteria nucleic acid fingerprint characteristic spectrums and application thereof
  • 16S rDNA based preparation method of bacteria nucleic acid fingerprint characteristic spectrums and application thereof
  • 16S rDNA based preparation method of bacteria nucleic acid fingerprint characteristic spectrums and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0111] Example 1. The establishment of a single bacterial nucleic acid fingerprint feature map

[0112] 1. Design and select universal primers

[0113] According to the conserved region (SEQ ID No: 3) of the 16S rDNA of Listeria monocytogenes (Listeria monocytogenes EGD-e, NCBI accession number: NC_003210.1), the general PCR primers were designed, respectively:

[0114] 5-aggaagagagAGAGTTTGATCCTGGCTCAG-3 (SEQ ID No: 1)

[0115] 5-cagtaatacgactcactatagggagaaggctCTGCTGCGTCCCGTAG-3 (SEQ ID No: 2)

[0116] Among them, the sequences AGAGTTTGATCCTGGCTCAG and CTGCTGCGTCCCGTAG respectively match the 16S rDNA region to be amplified, and aggaagagag and cagtaatacgactcactatagggagaaggct are additional sequences added to the upstream and downstream PCR primers to ensure that in order to transcribe the PCR product, the 5' end of the primer of SEQ ID No: 1 contains 10bp The tag (aggaagagag), the 5' end of the primer of SEQ ID No: 2 contains a 31bp tag (cagtaatacgactcactatagggagaaggct).

[...

Embodiment 2

[0161] Example 2, small-scale verification of the preparation method of the nucleic acid fingerprint characteristic map of implementation 1

[0162] Using the method and primers described in Example 1, Acetobacter pasteurianus IFO 3283-01 and Azorhizobium caulinodans ORS 571 chromosome were digested and identified by mass spectrometry.

[0163] Repeat twice to get the same nucleic acid fingerprint feature spectrum, where figure 2 , image 3 The nucleic acid fingerprint characteristic maps of Acetobacter and nitrogen-fixing rhizobia are shown respectively.

Embodiment 3

[0164] Embodiment 3, the establishment of the nucleic acid fingerprint feature map library of bacteria

[0165] According to the method and primers described in Example 1, the bacteria listed in Table 1 were digested and identified by mass spectrometry, and the nucleic acid fingerprints of all bacteria were obtained.

[0166] These feature maps are integrated and analyzed by Bioexplore software to obtain a nucleic acid fingerprint feature map library including most bacteria.

[0167] As shown in table 2, Figure 4 - Figure 100 The nucleic acid fingerprint feature maps of 97 kinds of bacteria are displayed respectively.

[0168]

[0169]

[0170] Table 2 (Note: Table 2 is the content in italics in Table 1)

[0171] Figures 101-103 It is the nucleic acid fingerprint characteristic map of sheep, cattle, and suis Brucella, Figure 104 It is the nucleic acid fingerprint characteristic map of Mycobacterium tuberculosis, Figure 105 It is the nucleic acid fingerprint char...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for preparing bacteria 16S rDNA fingerprint spectrums. The method comprises the steps of PCR (polymerase chain reaction) amplification, SAP (super absorbent polymer) enzymatic digestion, transcription and nuclease digestion, purification, mass spectrometer detection and the like. A nucleic acid fingerprint spectrum database of common bacteria is created based on the method. According to the mass spectrum peak chart generated through experiments, the bacteria to be detected can be classified and identified and the results can be widely applied to the fields of bacteria classification and identification, genetic evolution analysis, drug resistance screening application, import and export inspection and the like.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a method for preparing bacterial nucleic acid fingerprints and a method for classifying and identifying bacteria using the method. Background technique [0002] The early bacteriological classification mainly adopted the traditional bacteriological classification method based on morphological and cultural characteristics and physiological and biochemical characteristics. However, because the surface characteristics of bacteria are often affected and limited by many human factors, especially the differences in people's subjective judgments, it is difficult to reflect the natural kinship of bacteria, which reflects the fact that bacteria are only based on morphological characteristics and physiological and biochemical characteristics. limitations of traditional taxonomies. [0003] Therefore, Colweel proposed a new bacterial taxonomy term "Polyphasic taxonomy", which refers to the metho...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12R1/32C12R1/01
Inventor马庆伟赵洪斌张海燕赵艳梅
Owner向华