A method for displaying foreign protein macromolecules on the surface of t4 bacteriophage using the intracellular synchronous expression method
A technology of exogenous protein and phage, which is applied in the fields of biochemistry and molecular biology, can solve the problems of overexpression of exogenous recombinant protein, solution solubility of recombinant protein and separation and purification efficiency, so as to avoid protein separation and purification Process, manpower saving effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1. A method for displaying foreign protein macromolecules on the surface of T4 phage using synchronous intracellular expression. The steps are as follows:
[0026] (1) The construction of the expression plasmid of the Hoc protein with the natural regulatory region of T4 phage or the recombinant protein fused with the Soc protein and foreign protein:
[0027] (1) Fusion of the gene coding region of the Hoc protein or Soc protein with the gene coding region of the foreign protein to be displayed, and adding the natural regulatory region of T4 phage to control the expression of Hoc protein or Soc protein in the upstream of the sequence; foreign protein selection From any protein; after fusion, a gene sequence encoding Hoc protein or a recombinant protein fused with foreign protein with regulatory sequence is formed; plasmids containing this sequence will be synchronized in the process of infection and assembly of T4 phage in E. coli cells Express foreign recombinant pro...
experiment example
[0034] Experimental examples, the following two examples illustrate the technical solution of the present invention.
[0035] Two naturally folded, functionally complete foreign proteins: GG protein and gal protein are fused with Soc protein and Hoc protein respectively to form recombinant protein, which is displayed on the capsid of T4 phage by synchronous intracellular expression.
[0036] (1) Construction of the expression plasmid of the recombinant protein fused with Soc protein and gal protein:
[0037] (1) Amplify the gene sequence of the Soc protein by PCR, including its promoter region (the gene sequence of the Soc protein promoter region is: tataaataatcatgtaatttaaataaaggagaattac). Primer 1 is the first 18 bases of the gene sequence in the promoter region of the Soc protein. Primer 2 is the reverse complement of the following sequence: the last 21 bases of the coding region of the Soc protein gene remove the stop codon, plus the first 18 bases of the coding region of the gal...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap