Method for knocking out ZFNs (zinc finger nucleases)-mediated bovine MSTN (myostatin) gene and integrating exogenous gene at fixed point

Abstract

The invention provides a method for knocking out a ZFNs (zinc finger nucleases)-mediated bovine MSTN (myostatin) gene and integrating an exogenous gene at the fixed point. The method comprises the following steps of: designing a specific locus expression vector of the ZFNs according to a bovine MSTN gene sequence; designing a target vector according to an acting site of the ZFNs, wherein the target vector contains the exogenous gene and can be integrated into a host genome; and transferring the expression vector and the target vector into a bovine fibroblast to obtain a cell for knocking out the bovine MSTN gene and integrating the exogenous gene at the fixed point. The DNA sequence acting on the designed specific ZFNs is located on the exon of the bovine MSTN gene. The constructed ZFNs-mediated target vector provides a way for easily and quickly knocking out the bovine MSTN gene and inserting the exogenous gene at the fixed point and has an important value to the genetic breeding of the new double-muscle bovine variety.

Description

technical field

[0001] The invention relates to the field of molecular biology, in particular to a method for ZFNs-mediated knockout of bovine MSTN gene and site-specific integration of foreign genes. Background technique

[0002] Myostatin (MSTN) belongs to the TGF-β superfamily and is a negative regulator of skeletal muscle growth and development. Loss or reduction of its activity will cause excessive muscle development in animals and form "double muscle". There are many kinds of animals in nature with this double muscle phenomenon, including pigs, dogs, cattle, and even humans. Among naturally selected livestock, Belgian Blue and Piedmontese are typical bimuscular animals. Both are caused by the mutation of the MSTN gene. The former is the deletion of 11bp nucleotides in the third exon of the MSTN sequence, resulting in the mutation of the MSTN reading frame, and the resulting MSTN protein cannot exert its biological activity; the latter Mutations occurred in both the f...

Examples

Embodiment 1

[0075] Example 1 Construction of ZFN expression vector

[0076] The full-length DNA sequence of MSTN was obtained from GenBank, and two sets of zinc finger ribozyme vectors were designed for the second exon, named bMK-I and bMK-II, respectively. bMK-I includes bZFN-1 and bZFN-2. Plasmids, bMK-II includes two plasmids, bZFN-3 and bZFN-4 (completed by Sigma-Aldrich), and two sets of zinc finger ribozyme vectors were introduced into different bovine fetal embryos by liposome co-transfection. In the fibroblasts, single cells were then picked to establish multiple single cell lines, the same cell line was divided into two parts, passaged and cryopreserved respectively, the genome was extracted from the passaged cell lines, and PCR detection primers across the action sites were used for amplification. The amplified products were sequenced and identified, and finally the mutant cell line at the action site of the zinc finger ribozyme was obtained.

[0077] Genomic DNA was obtained f...

Embodiment 2

[0082] Example 2 Extraction of bovine fetal fibroblast genome

[0083] The cells cultured in a 100mm petri dish were digested and collected by centrifugation. The Wizard Genomic DNA Purification Kit (Promega) was used to extract bovine genomic DNA according to the method for extracting cell genomes. Finally, the DNA was re-dissolved in 100 μL of ultrapure water. . Use a UV spectrophotometer to detect the concentration and purity of the extracted DNA for subsequent work.

Embodiment 3

[0084] Example 3 Construction of MSTN gene homology arms pMD19-T-LA-1 and pMD19T-LA-2, pMD19-T-RA-1 and pMD19T-RA-2

[0085] According to Accession No.NC_007300.5 in the template sequence GenBank, the upstream primer LH-1U ( ACGCGT ATCCTGGAATAGATTTGCCTTACT) and downstream primer LH-1D ( ACGCGT GGATTTGCACAAACACTGTCGC); the upstream primer RH-1U ( GCTAGC ATCCGATCTCTGAAACTTGAC) and downstream primer RH-1D ( GCTAGC TTTTAATTTTACCAGGGGTAATT ); upstream primer LH-2U ( ACGCGT TGTCCCAGCGTCCTAACATAACA) and downstream primer LH-2D ( ACGCGT CAGCAAGATCATGGCCATTCTC); the upstream primer RH-2U ( GCTAGC GTGATTACTGAAAAATAACATGC) and downstream primer RH-2D ( GCTAGC GAAGAGTGAGTAGCTCTAAAC); the underlined part is the restriction site. Using the above-mentioned bovine genomic DNA as a template, the homology arms were synthesized by PCR respectively.

[0086] PCR reaction system (20 μL): 1 μL of upstream and downstream primers, 1 μL of template, 2 μL of 10× reaction, 1.6 μL of 2.5mM...

technical field

[0001] The invention relates to the field of molecular biology, in particular to a method for ZFNs-mediated knockout of bovine MSTN gene and site-specific integration of foreign genes. Background technique

[0002] Myostatin (MSTN) belongs to the TGF-β superfamily and is a negative regulator of skeletal muscle growth and development. Loss or reduction of its activity will cause excessive muscle development in animals and form "double muscle". There are many kinds of animals in nature with this double muscle phenomenon, including pigs, dogs, cattle, and even humans. Among naturally selected livestock, Belgian Blue and Piedmontese are typical bimuscular animals. Both are caused by the mutation of the MSTN gene. The former is the deletion of 11bp nucleotides in the third exon of the MSTN sequence, resulting in the mutation of the MSTN reading frame, and the resulting MSTN protein cannot exert its biological activity; the latter Mutations occurred in both the f...

Examples

Embodiment 1

[0075] Example 1 Construction of ZFN expression vector

[0076] The full-length DNA sequence of MSTN was obtained from GenBank, and two sets of zinc finger ribozyme vectors were designed for the second exon, named bMK-I and bMK-II, respectively. bMK-I includes bZFN-1 and bZFN-2. Plasmids, bMK-II includes two plasmids, bZFN-3 and bZFN-4 (completed by Sigma-Aldrich), and two sets of zinc finger ribozyme vectors were introduced into different bovine fetal embryos by liposome co-transfection. In the fibroblasts, single cells were then picked to establish multiple single cell lines, the same cell line was divided into two parts, passaged and cryopreserved respectively, the genome was extracted from the passaged cell lines, and PCR detection primers across the action sites were used for amplification. The amplified products were sequenced and identified, and finally the mutant cell line at the action site of the zinc finger ribozyme was obtained.

[0077] Genomic DNA was obtained f...

Embodiment 2

[0082] Example 2 Extraction of bovine fetal fibroblast genome

[0083] The cells cultured in a 100mm petri dish were digested and collected by centrifugation. The Wizard Genomic DNA Purification Kit (Promega) was used to extract bovine genomic DNA according to the method for extracting cell genomes. Finally, the DNA was re-dissolved in 100 μL of ultrapure water. . Use a UV spectrophotometer to detect the concentration and purity of the extracted DNA for subsequent work.

Embodiment 3

[0084] Example 3 Construction of MSTN gene homology arms pMD19-T-LA-1 and pMD19T-LA-2, pMD19-T-RA-1 and pMD19T-RA-2

[0085] According to Accession No.NC_007300.5 in the template sequence GenBank, the upstream primer LH-1U ( ACGCGT ATCCTGGAATAGATTTGCCTTACT) and downstream primer LH-1D ( ACGCGT GGATTTGCACAAACACTGTCGC); the upstream primer RH-1U ( GCTAGC ATCCGATCTCTGAAACTTGAC) and downstream primer RH-1D ( GCTAGC TTTTAATTTTACCAGGGGTAATT ); upstream primer LH-2U ( ACGCGT TGTCCCAGCGTCCTAACATAACA) and downstream primer LH-2D ( ACGCGT CAGCAAGATCATGGCCATTCTC); the upstream primer RH-2U ( GCTAGC GTGATTACTGAAAAATAACATGC) and downstream primer RH-2D ( GCTAGC GAAGAGTGAGTAGCTCTAAAC); the underlined part is the restriction site. Using the above-mentioned bovine genomic DNA as a template, the homology arms were synthesized by PCR respectively.

[0086] PCR reaction system (20 μL): 1 μL of upstream and downstream primers, 1 μL of template, 2 μL of 10× reaction, 1.6 μL of 2.5mM...

Images