Unlock instant, AI-driven research and patent intelligence for your innovation.

Cas9 gene knockout vector suitable for endophytic fungi A761 of Morinda officinalis, construction method and application thereof

An endophytic fungus and construction method technology, applied in the fields of biochemistry and molecular biology, can solve the problem of fewer filamentous fungi, achieve convenient construction, high gene knockout efficiency, and promote development and utilization

Active Publication Date: 2020-04-24
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The CRISPR / Cas9 system has been widely used in the genome editing of eukaryotic cells such as mammalian cells, stem cells and plants due to the advantages of high gene knockout efficiency, simple construction, and low cost. However, due to the lack of corresponding vectors, CRISPR The / Cas9 system is rare in filamentous fungi, and there is no research on the gene editing of endophytic fungi in Guangdong medicinal plants.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cas9 gene knockout vector suitable for endophytic fungi A761 of Morinda officinalis, construction method and application thereof
  • Cas9 gene knockout vector suitable for endophytic fungi A761 of Morinda officinalis, construction method and application thereof
  • Cas9 gene knockout vector suitable for endophytic fungi A761 of Morinda officinalis, construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Construction of Example 1 Gene Knockout Vector PFC332-sgRNA-bam

[0022] According to the BAM sequence, the BAM target sequence 5'-GCAGTGGGAACAGGAGAGAT-3' was designed on the website http: / / www.e-crisp.org / E-CRISP / index.html. Design the 5srRNA promoter, the sgRNA containing the target sequence and the corresponding terminator fragment, and integrate the two fragments together by homologous recombination to obtain the 5SrRNA-bam-sgRNA-ter fragment, whose sequence is shown in SEQ ID NO.1. details as follows:

[0023] Design 5SrRNA amplification primers, respectively 5SrRNA-F: 5′-CGGGAAGATCTCACATACGACCACAGGG-3′, 5SrRNA-R: 5′-CATACAACAGAAGGGATTCGCTGGTG-3′,

[0024] Amplification primers of the sgRNA fragment containing the target sequence: sgRNA-F: 5′-αCGAATCCCTTCTGTTGTGCAGTGGGAACAGGAGAGATGGGGTTTTTAGAGCTAGA-3′, sgRNA-R: 5′-GTCTTAATTAAGCGGCCCCTCTAGATGCATGC-3′.

[0025] Primers were synthesized by Guangzhou Tianyi Huiyuan Company.

[0026] Using the 5SrRNA promoter fragmen...

Embodiment 2

[0031] Knockdown of the cytosporaphenones biosynthesis gene bam in C. rhizophorae A761:

[0032] The method for introducing the recombinant knockout vector PFC332-sgRNA-bam into C. rhizophorae A761 protoplasts is as follows:

[0033] The C. rhizophorae A761 hyphae were transferred to PDA plates with hygromycin concentrations of 0 μg / mL, 20 μg / mL, 40 μg / mL, 60 μg / mL, and 80 μg / mL for hygromycin resistance screening. The results showed that C.rhizophorae A761 could not grow when the hygromycin concentration was 80 μg / mL ( image 3 A).

[0034] Cytospora rhizophorae A761 mycelia were inoculated in PDA liquid medium and cultured for 7 days, 2 g of the better-growing bacteria were taken, and the bacteria were washed twice with PBS. Dissolve 0.15 g of lyase in 20 mL of KC buffer, filter with a 0.22 μm filter membrane, then add the washed bacteria, and lyse at 28°C for 3 hours at 68 r / min. Pour the lysed bacterial solution into a strainer to filter to remove mycelium, and filter a...

Embodiment 3

[0037] Knockout verification and product comparison analysis of the bam gene in Example 3C.rhizophorae A761

[0038] Genomic DNA was extracted from the wild C. rhizophorae A761 strain and the bam knockout C. rhizophorae A761 strain, using the left homology arm upstream primer LF and the right homology arm primer RR as primers, using the extracted genome as a template, and using Prime STAR MAX (TAKARA, Japan) for amplification. The results showed that when the genomic DNA of the wild A761 strain was used as a template, a target fragment of 3.5 kb could be amplified, and when the genomic DNA of the bam gene knockout C. rhizophorae A761 strain was used as a template, a fragment of about 1.5 kb was obtained, proving that bam The gene was successfully knocked out ( Figure 5 ).

[0039] Inoculate the wild C.rhizophorae A761 strain and the bam gene knockout C.rhizophorae A761 strain into PDA medium, and culture them at 28°C and 180rpm for 7 days. The fermentation product was extr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Cas9 gene knockout vector suitable for endophytic fungi A761of Morinda officinalis, a construction method and application thereof. The invention discloses, for the first time, the application of CRISPR / Cas9 technology to construct a new type of benzophenone compound biosynthesis gene bam knocked recombinant C. rhizophorae strain, laying a molecular biological foundation for elucidating the biosynthesis mechanism of cytosporaphenones in endophytic fungi C. rhizophorae of Morinda officinalis. The invention discloses, for the first time, the application of the CRISPR / Cas9 system to knock out cysporaphenones biosynthesis gene of endophytic fungi C. rhizophorae A761 of Morinda officinalis, and a CRISPR / Cas9 gene knockout system of endophytic fungi C. rhizophorae A761 of Morinda officinalis is established, thereby promoting the genetic engineering modification of C. rhizophorae and laying a molecular biological foundation for discovering more novel benzophenone cytosporaphenones derivatives with significant biological activity.

Description

technical field [0001] The invention relates to the fields of biochemistry and molecular biology, in particular to a Cas9 gene knockout vector suitable for endophytic fungus A761 of Morinda officinalis and its construction method and application. Background technique [0002] Cytospora rhizophorae A761 is an endophytic fungus isolated from Morinda officinalis. The endophytic fungus can produce a series of cytosporaphenone compounds with novel skeletons and highly oxidized benzophenones, and these compounds have good antitumor activity and strong antibacterial activity, and have the potential to be developed as agricultural antibacterial agents and insecticides potential. Benzophenone compounds are widely used in fields such as medicine, industry and agriculture, such as in medicine, they can be used as intermediates or raw materials for drugs such as ketoprofen, diazepam, diphenhydramine, and dicyclohexyl piperidine; On the one hand, it can be used as an intermediate for u...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/15C12N15/90C12N15/80C12N15/66C12R1/645
CPCC12N15/902C12N15/80C07K14/37
Inventor 叶伟孔亚丽章卫民朱牧孜李赛妮刘洪新岑由飞刘珊
Owner GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY