Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for detecting egg laying amount of insects by vitellogenin gene

A technology for vitellogenin and insect egg production, which is applied in the field of detecting insect egg production by using vitellogenin gene, can solve the problems of time-consuming, labor-intensive and expensive, and achieves the effects of easy purchase, simple operation and wide source of materials.

Inactive Publication Date: 2013-05-08
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the detection method for the egg production of commercial stinkbugs from different food sources or different merchants is still to test the egg production during the entire adult stage or within an artificially specified time, which is time-consuming, laborious and expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting egg laying amount of insects by vitellogenin gene
  • Method for detecting egg laying amount of insects by vitellogenin gene
  • Method for detecting egg laying amount of insects by vitellogenin gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1. Discovery of vitellogenin and its coding gene for detecting insect egg production and design of special primers

[0043] Studies have found that the vitellogenin gene is a good molecular marker for detecting the amount of eggs laid by insects, so the present invention detects the amount of eggs laid by insects by detecting the expression of the gene encoding vitellogenin.

[0044] The nucleotide sequence of the vitellogenin coding gene of the gnat bug is sequence 1 in the sequence listing or sequence 1 in the sequence listing from the 39th to 1007 nucleotides at the 5' end, and the amino acid sequence of the protein is the sequence listing in the sequence listing sequence 2.

[0045] The primers designed to amplify the coding gene according to the vitellogenin coding gene of the stinkbug are as follows:

[0046] Upstream primer: TAGTTCGCAAAGGAGTGGTTGA (SEQ ID NO: 3);

[0047] Downstream primer: AGATTCTTGCAACTGCTTTCGG (SEQ ID NO: 4).

Embodiment 2

[0048] Example 2, Application of Vitellogenin or Encoding Gene or Special Primer in Detecting Oviposition

[0049] The cockroach (Arma chinensis) adopted in the following experiments is recorded in Taxonomic and bionomic notes on Arma chinensis (Fallou) (Hemiptera: Pentatomidae: Asopinae, Zootaxa, 3382: 41-52, 2012, the public can obtain from Chinese Academy of Agricultural Sciences Plant Protection Research Obtained) were divided into two groups according to the difference of food quality, 50 in each group:

[0050] Cockbugs eating artificial diet: Cockbugs fed artificial diet (27±1°C, 16:8(L:D), 75±5%RH) were fed with 160 μl of artificial diet per adult per day until the Stinkbugs die naturally;

[0051] The prey-feeding group of gnats: the gnats that feed on prey (27±1°C, 16:8(L:D), 75±5%RH) each pair of adults feeds one prey, every 7-15 days according to When the prey is eaten, the prey is replaced once until the stinkbug dies naturally;

[0052] The artificial feed is ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting the egg laying amount of insects by a vitellogenin gene, which provides application of a substance which is used for detecting the expression quantity of vitellogenin encoding genes of insect populations eating different substances to detection of the egg laying amount of insect populations eating different substances, wherein the amino acid sequence of vitellogenin is a sequence 2 in the sequence list. Experiments prove that the detection method provided by the invention can be used for detecting the egg laying amount of the insects and particularly the egg laying amount of arma chinensis with different nutrition sources, and the egg laying amount of the insects can be detected within only 2 to 3 days by the detection method while the detection requires 30 to 60 days by a traditional biological method. The detection method provided by the invention has the advantages that materials have wide sources and are easily available, and the operation is simple as well as time-saving and labor-saving, thus being suitable for popularization and application in insect commodity inspection and detection.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for detecting insect egg production by using vitellogenin gene. Background technique [0002] Biological pest control plays an irreplaceable and important role in the sustainable development of agriculture and forestry. The mass production of natural enemy insects is the most basic and important link in biological control. The predatory natural enemy insect, Arma chinensis, can control a variety of agricultural and forestry pests from Lepidoptera, Coleoptera, Hemiptera, Homoptera, Hymenoptera, etc., especially it can also control the major invasive pests potato beetle and The American white moth, therefore, is a natural enemy insect commodity with good application prospects. [0003] As a commodity, reducing the cost of production is a way for people to pursue profit maximization. In the production of the natural enemy insect, the stink bug, different foods can be used to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11C07K14/435C12N15/12
Inventor 邹德玉陈红印张礼生王树英陈长风王孟卿刘晨曦
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More