Recombined Talpha 1-BP5 fusion peptide, gene, engineering bacteria and application

A 1-BP5 and fusion peptide technology, applied in the field of bioengineering, can solve the problems of high content of miscellaneous proteins, difficult purification, unsuitable for field promotion, etc., achieve broad application prospects, good immune adjuvant effect, and enhance the body's cellular immunity and the effect on humoral immunity levels

Inactive Publication Date: 2013-06-12
HENAN UNIV OF SCI & TECH
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Since bursa pentapeptide BP5 can only be extracted from chicken bursa tissue, and thymosin α1 is extracted from thymus tissue, the source is very limited, and the content of other miscellaneous proteins is high, the purification is difficult, and its actual effect is also limited. heavily influenced by
However, chemically synthesized thymosin α1 or bursa active pentapeptide BP5 are expensive and not suitable for field promotion.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombined Talpha 1-BP5 fusion peptide, gene, engineering bacteria and application
  • Recombined Talpha 1-BP5 fusion peptide, gene, engineering bacteria and application
  • Recombined Talpha 1-BP5 fusion peptide, gene, engineering bacteria and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1, Construction of Engineering Bacteria Expressing Recombinant Tα1-BP5 Fusion Peptide

[0043] 1. SOE-PCR amplification of recombinant Tα1-BP5 fusion peptide gene

[0044] 1) Design primers

[0045] Design the recombinant Tα1-BP5 fusion peptide gene according to the biased codon of porcine Escherichia coli, as follows:

[0046] 5'-AGCGACGCTGCTGTTGACACTAGCAGCGAAATCACTACTAAAGACTTGAAAGAA AAAAAGAAGTTGTTGAAGAAGCTGAAAACGGCGGCGGCGGCAGCTGCAAAAATGTG TAT-3' (SEQ ID NO: 1)

[0047] And design primer F for this fusion peptide gene 1 , F 2 and F 3 , where in primer F 1 Add EcoRI restriction site, primer F 3 Add a stop codon and a SalI restriction site, and the primers were synthesized by Shanghai Invitrongen Company, as follows:

[0048] f 1 : 5'-CCG GAATTC AGCGACGCTGCTGTTGACACTAGCAGCGAAATCACTACTAAAG ACTTG-3' (SEQ ID NO: 2), wherein the underlined part is the EcoRI restriction site;

[0049] f 2 : 5'-GTTCGGGGTGCTGCCGCCGCCGCCGTTTTCAGCTTCTTCAACAACTTCTTTTTTTTCTTTCAA...

Embodiment 2

[0058] Embodiment 2, preparation of recombinant Tα1-BP5 fusion peptide

[0059] 1. Inoculate the engineered bacteria expressing the recombinant Tα1-BP5 fusion peptide into 3mL LB liquid medium (50μg / mL ampicillin), and cultivate overnight at 37°C with shaking; the next day, take out the bacterial liquid and add it to 3mL LB liquid culture base, so that the cell concentration reached OD 600 After ≈0.1, shake culture at 37°C, when the cell concentration OD 600 When ≈0.4-0.6, add IPTG to induce expression for 4 hours, the final concentration of IPTG is 1mM; collect 100 μL of bacterial liquid every 1 hour, and perform SDS-PAGE on the expression of recombinant Tα1-BP5 fusion peptide in E. coli at different induction times analysis, such as figure 2 shown. Centrifuge the bacterial solution at 4000rpm for 10min, collect the bacterial cells, resuspend the collected bacterial cells with 100μL PBS, add an equal volume of 2×SDS gel loading buffer (100mmol / L Tris Cl (pH6.8), 200mmol ...

experiment example 1

[0067] Experimental example 1, in vitro activity determination of recombinant Tα1-BP5 fusion peptide

[0068] Mouse lymphocytes were isolated by conventional methods and placed in CO 2 Incubate in an incubator at 37°C for 6 h; add different concentrations of recombinant Tα1-BP5 fusion peptides (20 μmoL / L, 10 μmoL / L, 5 μmoL / L, 2.5 μmoL / L, 1.25 μmoL / L) into wells containing lymphocytes, each The well was 100 μL, and a control group (PBS, 10 μmoL / L thioredoxin (TRx), 10 μmoL / L standard Tα1, 10 μmoL / L BP5) was set up, and the in vitro activity of the recombinant Tα1-BP5 fusion peptide was determined by MTT method. The results are as follows: Figure 4 shown. From Figure 4 It can be seen that the recombinant Tα1-BP5 fusion peptide of the present invention can significantly promote the division and proliferation of lymphocytes. Compared with single thymosin α1 and bursa pentapeptide BP5, the recombinant Tα1-BP5 fusion peptide of the present invention stimulates The proliferative...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombined Talpha 1-BP5 fusion peptide, a gene, an engineering bacteria and an application. The recombined fusion peptide is prepared by fusing thymosin alpha 1 with Fabricius bursa pentapeptide BP5 through a soft Linker. The recombined Talpha 1-BP5 fusion peptide gene is inserted into an expression vector to transfer the escherichia coli so as to obtain the gene engineering bacteria for effectively express the Talpha 1-BP5 fusion peptide; the Talpha 1-BP5 fusion peptide is prepared through liquid cultivation and purification; and the thioredoxin of the fusion peptide is eliminated by using enterokinase with His tag at the N-end, and the fusion peptide is further subjected to affinity chromatography purification so as to obtain the single recombined Talpha 1-BP5 fusion peptide. The recombined Talpha 1-BP5 fusion peptide disclosed by the invention can be used as a novel polypeptide immunologic adjuvant which is used in match with vaccines, can effectively enhance the organism cell immune level and the body liquid immune level, and has wide application prospects.

Description

technical field [0001] The invention relates to a recombinant fusion peptide of thymosin α1 and Bursa pentapeptide BP5, and also relates to a gene encoding the recombinant fusion peptide, an engineering bacterium expressing the fusion peptide and its application, belonging to the technical field of bioengineering. Background technique [0002] Thymus is an important central immune organ in the immune system, responsible for cell differentiation and maturation, thymus tissue produces a variety of hormones or factors, among which thymosin α1 (Tα1) is a highly conserved small molecular active peptide, rich in acidic amino acids, Composed of 28 amino acids, Tα1 is produced by thymic epithelial cells and thymic endocrine cells, and widely exists in the body's thymic epithelial cells, peripheral blood, brain, pituitary, semen, follicular fluid and amniotic fluid; in some protective cells and activation There is also Tα1 in the supernatant of lymphocytes; there is a considerable le...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62C12N1/21C12N15/70A61K39/39C12R1/19
Inventor王臣冯书营赵战勤牛明媚郭香玲李振华李小康刘一尘张春杰
OwnerHENAN UNIV OF SCI & TECH