Construction and application of plant expression carrier pGII0229-GUS
The technology of a plant expression vector, pgii0229-gus, is applied in the biological field to achieve good results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1: Construction method of a plant expression vector pGⅡ0229-GUS
[0035] A method for constructing a plant expression vector pGII0229-GUS, comprising the following steps:
[0036] 1. Primer design: artificially design and synthesize specific primer sequences
[0037] Forward primer: 5’- GCAAGCTTTTTCCCGCCTTCAGTTTAGC - 3’
[0038] Reverse primer: 5'- GCTCTAGAACACTGATAGTTTAATTCC - 3';
[0039]2. PCR amplification: The preparation of the PCR reaction system is shown in Table 3.
[0040] Table 3 PCR reaction system preparation table
[0041]
[0042] The PCR program was pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 3 min, 30 cycles, and a final extension of 10 min;
[0043] 3. Carrier construction:
[0044] (1) Obtaining the target fragment I: separate the PCR amplification product in step 2 by agarose gel electrophoresis, and recover the target fragment I;
[0045] (2) Obtaining the targ...
Embodiment 2
[0048] Example 2: Application of a plant expression vector pGⅡ0229-GUS in Agrobacterium infection and transformation
[0049] The application of a plant expression vector pGⅡ0229-GUS in the infection and transformation of Agrobacterium comprises the following steps:
[0050] 1. Material selection: select the plant expression vectors pGⅡ0229-GUS and pCAMBIA2301 carrying the GUS gene, and introduce them into Agrobacterium tumefaciens ( Agrobacterium tumefaciens ) strain EHA105, obtain A bacterial liquid and B bacterial liquid; the A bacterial liquid is a positive bacterial liquid containing the plant expression vector pGⅡ0229-GUS, and the B bacterial liquid is a positive bacterial liquid containing the plant expression vector pCAMBIA2301; the selected sugarcane variety is Funong 39; for the introduction method, refer to the article "Research on freeze-thaw method of introducing recombinant plasmid into Agrobacterium tumefaciens" published by Yu Yunzhou et al. in the Journal of ...
Embodiment 3
[0057] Example 3: Application of a plant expression vector pGⅡ0229-GUS in gene gun bombardment transformation
[0058] The application of a plant expression vector pGⅡ0229-GUS in gene gun bombardment transformation comprises the following steps:
[0059] 1. Material selection: select the plant expression vectors pGⅡ0229-GUS and pCAMBIA2301 carrying the GUS gene, measure the concentration and purity of pGⅡ0229-GUS plasmid DNA and pCAMBIA2301 plasmid DNA with a nucleic acid protein analyzer, and quantify the two plasmid DNAs to 1 μg / μl; choose the sugarcane variety as Funong 39;
[0060] 2, the pretreatment of acceptor material: at the top part of sugarcane plant, get the tender heart leaf within 10 cm above the growth point in the hypertrophy zone of white heart leaf, after being 75% ethanol disinfection with volume concentration, and it is cut The discs with a thickness of no more than 3 mm were inoculated on the induction culture of MS+3.0 mg / L 2.4-D+20 g / L sucrose+6 g / L aga...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More