Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for remaking multiple cloning sites of known vector

A technology of multiple cloning sites and vectors, applied in the field of cloning, can solve problems such as low operational flexibility, low construction efficiency, and low yield of fragments, and achieve high flexibility, easy operation, and high efficiency

Inactive Publication Date: 2013-07-10
YANGZHOU UNIV
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because the multiple cloning site sequence in the vector is usually short, about 100bp, the yield of the digested fragments in the gel recovery is usually not high, resulting in low construction efficiency
Niu Lin et al. proposed to insert a 238bp auxiliary fragment into the MCS of the vector, then use this MCS to replace the MCS of the vector to be transformed, and finally excise the inserted auxiliary fragment to complete the transformation of the vector, but this method requires the original MCS Template sequence, resulting in less operational flexibility

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for remaking multiple cloning sites of known vector
  • Method for remaking multiple cloning sites of known vector

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach 1

[0023] Embodiment 1: Transformation of multiple cloning sites of plant expression vector pCAMBIA1301 / Ubi

[0024] In the research work of this experiment, a fragment of 8.2kb needs to be connected into the overexpression vector pCAMBIA1301 / Ubi, and the analysis of the restriction site shows that the restriction site suitable for this fragment is only Kpn I and Speech 1, and the available enzyme cutting point on the overexpression vector pCAMBIA1301 / Ubi is Bam H I and Sac I, in order to successfully connect the target fragment into the vector, the adapter primer-PCR method will Kpn I and Speech The I restriction site was introduced into the multiple cloning site of the pCAMBIA1301 / Ubi vector.

[0025] 1) Design of adapter primer pairs

[0026] Using a pair of existing primer pair SS with better amplification efficiency, namely SS-F: 5'ACCTATCACCAAATGTACCC3', SS-R: 5'CAATCCTCAATATGCTCAAC3' as the basic primers, the primer pair SS is derived from rice genomic DNA,...

specific Embodiment approach 2

[0029] Specific embodiment two: Transformation of multiple cloning sites of plant expression vector pCAMBIA2300

[0030] In another research work, we need to use the Hind III and Apa I and contain Hind III and Speech I The pCAMBIA2300 vector of the restriction site, we also transformed the known multiple cloning site of pCAMBIA2300 by the adapter primer-PCR method.

[0031] 1) Design of adapter primers

[0032] A pair of existing primer pair H with better amplification efficiency was used as basic primers, namely H-F: 5'TCATGGAGTCAAAGATTC3', H-R: 5'AGTCCCCCGTGTTCTCTC3', and a pair of adapter primer pair H-SAP was designed. The basic primers were derived from Escherichia coli 35S promoter sequence, the size of the amplified fragment is 569bp, and the amplified sequence does not contain Hind III and Pst I digestion recognition sequence. We add Hind III Restriction site sequence and protective bases, the primer sequence before the adapter is obtained, which is...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for remaking multiple cloning sites of a known vector, namely an adapter primer-PCR (Polymerase Chain Reaction) method. The method comprises the following steps of: amplifying the known DNA (Deoxyribonucleic Acid) fragment of any species by applying an adapter primer which respectively adds multiple restriction enzyme cutting sites to a 5' tail end; carrying out double enzyme cutting by using restriction enzymes positioned on both ends of the amplified fragment, and connecting to the multiple cloning sites of a vector to be remade by using a T4DNA joining enzyme; transforming a connected product into competent escherichia coli; and selecting positive clone, extracting plasmids, verifying whether the remade vector is carried with new enzyme cutting sites or not through enzyme cutting, and retaining a correct plasmid vector. The method disclosed by the invention can meet the requirements of a specific experiment by fast and conveniently adding the new enzyme cutting sites to the multiple cloning sites of the known vector, is low in cost and high in flexibility and can be applied to remaking the multiple cloning sites of the known vector.

Description

technical field [0001] The invention belongs to the technical field of cloning, and in particular relates to a method for transforming multiple cloning sites of known vectors. Background technique [0002] The directional cloning of the target sequence by double enzyme digestion is the most commonly used method in the vector construction process. This method can greatly reduce the self-ligation phenomenon of the vector itself during the recombination process and improve the construction efficiency. However, in many cases, especially when the target DNA fragment to be cloned is long, it is difficult to find two suitable restriction enzymes in the multiple cloning sites (MCS) of known vectors. location. In addition, during the double digestion process, the combination of some restriction enzymes will seriously reduce the digestion efficiency of each other or one of them, and ultimately affect the construction efficiency. Therefore, modifying the multiple cloning site of the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/66C12R1/19
Inventor 左示敏薛芗李磊张亚芳潘学彪陈宗祥
Owner YANGZHOU UNIV