Method for preparing active small peptide by establishing oligopeptide concatemer yeast expression plasmid

A technology of yeast expression and active small peptides, applied in the field of bioengineering, can solve the problems of low proportion of short peptides and low yield, and achieve the effect of low development cost

Inactive Publication Date: 2013-07-10
JILIN UNIV
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the relatively small molecular weight of these short peptides, they are easily degraded by host proteases during expression. The use of fusion protein expression technolog

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing active small peptide by establishing oligopeptide concatemer yeast expression plasmid
  • Method for preparing active small peptide by establishing oligopeptide concatemer yeast expression plasmid
  • Method for preparing active small peptide by establishing oligopeptide concatemer yeast expression plasmid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] (1) In order to make the two ends of the antimicrobial peptide contain a homologous enzyme and a protein cleavage site, the enzyme cleavage sites of Xho I and Sal I were respectively introduced when designing the upstream and downstream primers of the antimicrobial peptide point. At the same time, the codon (ATG) of the cyanogen bromide (CNBr) protein cleavage site methionine (Met) was introduced at the amino terminus inside the enzyme cleavage site; the protein cleavage of hydroxylamine (NH2OH) was introduced at the carboxyl terminus. The codon AATGGA for the site (asparagine (Asn)-glycine (Gly)).

[0027] The gene coding sequence of the antimicrobial peptide is (its nucleotide sequence is shown in SEQ ID NO: 1; its amino acid sequence is shown in SEQ ID NO: 2):

[0028] aagtggaagtccttcctgaagaccttcaagtccgctgctaagactgttctgcatactgctctgaaggctatttcctcc;

[0029] Upstream primer (5'-3'):

[0030] tcgactcgagatgaagtggaagtccttcctgaagaccttcaagtccgctgctaagactgttctg;

[0031]...

Embodiment 2

[0044] (1) As in step (1) of Example 1.

[0045] (2) As in step (2) of Example 1.

[0046] (3) The obtained pBluescriptIISK+ recombinant plasmid was transformed into Escherichia coli DH5α, a single colony was picked on a plate with an ampicillin concentration of 100 mg / L, a small amount of plasmid was extracted, double-enzyme digested and sequenced for identification. Preserve the required strains (the plasmids contain 4-fold antimicrobial peptide concatemers in correct series), and extract the plasmids containing 4-fold antimicrobial peptide concatenations from them for the construction of expression plasmids.

[0047] (4) The pBluescriptIISK+ recombinant plasmid and the empty yeast expression plasmid pPICZa were double-digested with Xho I and Xba I restriction endonucleases respectively, and agarose gel electrophoresis was performed to recover 4 times of recombinant plasmids obtained by double-digestion The antibacterial peptide concatenated fragment (the nucleotide sequenc...

Embodiment 3

[0053] (1) As in step (1) of Example 1.

[0054] (2) As in step (2) of Example 1.

[0055] (3) The obtained pBluescriptIISK+ recombinant plasmid was transformed into Escherichia coli DH5α, a single colony was picked on a plate with an ampicillin concentration of 100 mg / L, a small amount of plasmid was extracted, double-enzyme digested and sequenced for identification. Preserve the desired strain (the plasmid contains the correct 8-fold antimicrobial peptide concatenation), and extract the plasmid containing the 8-fold antimicrobial peptide concatenation to construct an expression plasmid.

[0056] (4) The pBluescriptIISK+ recombinant plasmid and the empty yeast expression plasmid pPICZa were double-digested with Xho I and Xba I restriction endonucleases respectively, and agarose gel electrophoresis was performed to recover 8 times of recombinant plasmids obtained by double-digestion. The antimicrobial peptide concatenated fragment (its nucleotide sequence is shown in SEQ ID N...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for preparing an active small peptide by establishing an oligopeptide concatemer yeast expression plasmid, belongs to the technical field of biologic engineering. The method comprises the following steps of: amplifying by using an SOE-PCR (Splicing by Overlap Extension-Polymerase Chain Reaction) method so as to obtain a full-length gene of the oligopeptide; directionally and serially connecting the genes of a plurality of oligopeptides; establishing the obtained serial connected genes into an expression carrier of saccharomycete so as to convert the saccharomycete; and performing inducible expression on and the serial connected polypeptide and cutting into the target oligopeptide. The method has the characteristics that the various small molecule oligopeptides are effectively expressed by using saccharomycete, and the oligopeptides have important application values; and in addition, by utilizing the efficient expression of the serially connected oligopeptide plasmid, a product is very low in development cost.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a method for preparing active small peptides by constructing short peptide concatenated yeast expression plasmids. Background technique [0002] Many short peptides have very small molecular weight and consist of a dozen or dozens of amino acid residues, but they are functional and complete molecules with important irreplaceable activities. The number of amino acids in short peptides is small, and chemical synthesis has certain advantages. However, in the chemical synthesis of peptides, especially in the activation step, there is the possibility of amino acid racemization, and some molecules contain more modified amino acid residues. Chemical synthesis brings a lot of trouble. With the rapid development of molecular biology and genetic engineering technology, people try to use genetic engineering method to prepare many biological products with important practi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/81C12N15/62
Inventor 施维赵昊张桂荣李全顺于洋林雪贞
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap