Method for detection of HIV-1 nucleoside inhibitor drug resistance mutation and kit

A technology for HIV-1 and drug-resistant mutations, applied in the direction of microbial-based methods, biochemical equipment and methods, and microbial measurement/testing, can solve problems such as time-consuming, undetectable, and lack of quality assurance of detection methods

Inactive Publication Date: 2013-07-24
ZHEJIANG UNIV
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Phenotypic drug resistance is the gold standard for drug resistance detection. It directly provides drug resistance and can be quantified, but the disadvantages are also obvious, namely high technical requirements, time-consuming, and high cost. Therefore, gene is widely used in clinical practice internationally. type resistance detection
[0015] Further application limitations of genotypic and phenotypic testing include lack of quality assurance for existing testing methods; high cost of testing; insensitivity to parvovirus specimens; There are detection methods that may not detect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detection of HIV-1 nucleoside inhibitor drug resistance mutation and kit
  • Method for detection of HIV-1 nucleoside inhibitor drug resistance mutation and kit
  • Method for detection of HIV-1 nucleoside inhibitor drug resistance mutation and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0122] Embodiment 1, using the present invention to detect HIV-1 virus nucleoside reverse transcriptase inhibitor single-site drug-resistant mutation

[0123] In this embodiment, all HIV-1 virus nucleoside inhibitor drug-resistant mutation types involved in the present invention, as well as wild-type HIV-1 virus reverse transcriptase gene types that do not contain any mutations, are detected.

[0124] 1. Preparation of Oligonucleotide Primers and Probes

[0125] Table 1 and Table 2 show the sequences of primers and probes used in the detection of HIV-1 viral nucleoside reverse transcriptase inhibitor resistance mutations according to the present invention, all of which were synthesized by Shanghai Yingjun Biotechnology Co., Ltd.

[0126] Table 1 HIV-1 viral reverse transcriptase gene segment amplification primers

[0127]

Primer number

Primer sequence (5'-3')

PMV-001

gagagcttcaggtctgggg

PMV-002

CTGTTAGTGCTTTGGTTCCTCT

PMV-01...

Embodiment 2

[0191] Example 2: Using the present invention to detect HIV-1 virus nucleoside reverse transcriptase inhibitor multi-site and low-abundance drug-resistant mutations

[0192] This example illustrates that the method and kit provided by the present invention can simultaneously detect samples containing multiple nucleoside reverse transcriptase inhibitor resistance mutations of HIV-1 virus.

[0193] This example also shows that the method provided by the present invention can detect drug-resistant mutations with an abundance as low as 2% contained in the sample, and is a method with extremely high sensitivity.

[0194] 1. Preparation of Oligonucleotide Primers and Probes

[0195] Method and steps are the same as in Example 1.

[0196] 2. Preparation of HIV-1 Virus Nucleoside Reverse Transcriptase Inhibitor Resistance Mutation Detection Chip

[0197] Method and steps are the same as in Example 1.

[0198] 3. Preparation of samples to be tested

[0199] The samples to be tested...

Embodiment 3

[0220] Example 3: Using the present invention to detect drug-resistant mutations of HIV-1 virus nucleoside reverse transcriptase inhibitors in plasma, whole blood and nucleic acid samples

[0221] This example illustrates that the method and kit provided by the present invention can be used to detect HIV-1 viral nucleoside reverse transcriptase inhibitor resistance mutations in plasma, whole blood and nucleic acid samples.

[0222] 1. Preparation of Oligonucleotide Primers and Probes

[0223] Method and steps are the same as in Example 1.

[0224] 2. Preparation of HIV-1 Virus Nucleoside Reverse Transcriptase Inhibitor Resistance Mutation Detection Chip

[0225] Method and steps are the same as in Example 1.

[0226] 3. Preparation of samples to be tested

[0227] In this embodiment, clinically collected whole blood (WB-6-8), plasma (XJ-6-7) and nucleic acid (R-5-6, D-3) samples were tested. After high-throughput sequencing, whole blood sample WB-6 contained nucleoside rev...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for detection of HIV-1 (human immunodeficiency virus-1) nucleoside inhibitor drug resistance mutation and a kit thereof. Specifically, the invention discloses a specific probe for detection of human immunodeficiency virus nucleoside reverse transcriptase inhibitor drug resistance mutation, and the probe includes at least one of: a probe for detection of reverse transcriptase gene M41L mutation, a probe for detection of reverse transcriptase gene A62V mutation, a probe for detection of reverse transcriptase gene K65R mutation, a probe for detection of reverse transcriptase gene D67N mutation, a probe for detection of reverse transcriptase gene 69INS insertion mutation, a probe for detection of reverse transcriptase gene K70R mutation, a probe for detection of reverse transcriptase gene L74V mutation, a probe for detection of reverse transcriptase gene V75I mutation, a probe for detection of reverse transcriptase gene F77L mutation, a probe for detection of reverse transcriptase gene Y115F mutation, a probe for detection of reverse transcriptase gene F116Y mutation, and the like.

Description

technical field [0001] The invention relates to a method for detecting drug-resistant mutations of HIV-1 virus nucleoside inhibitors and a kit thereof. Background technique [0002] 1. Mechanism of nucleoside and nucleoside analog drugs: [0003] Human immunodeficiency virus (HIV) is a retrovirus and is divided into HIV-1 and HIV-2. AIDS patients in most parts of the world are infected by HIV-1 virus, and existing drugs mainly inhibit the replication of HIV-1 virus. The clinical course of HIV infection has changed significantly since the introduction of a new antiviral regimen, HAART in combination with reverse transcriptase inhibitors and protease inhibitors, in 1995. These drugs allow the immune system to rebuild its CD by blocking viral replication 4 + T cell repertoire and restore immunity to pathogens, significantly reducing the morbidity and mortality of HIV / AIDS-related diseases. Up to now, the U.S. FDA has approved a total of 26 antiviral drugs in 4 categories f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/93
Inventor张琼李兰娟项春生吴南屏
OwnerZHEJIANG UNIV