Recombination porcine interferon alpha1-Fc fusion protein as well as coding gene and expression method thereof

A porcine interferon, fusion protein technology, applied in chemical instruments and methods, microorganism-based methods, biochemical equipment and methods, etc., can solve the problems of insolubilization, reducing the specific activity rate of recombinant proteins, and unqualified product quality. The effect of prolonging half-life, long-acting, avoiding repeated medication, and controlling preparation cost

Active Publication Date: 2013-08-07
GENSUN INST OF BIOMEDICINE
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, most recombinant proteins expressed by E. coli are insoluble, inactive intracellular aggregates known as inclusion bodies
The renaturation of inclusion bodies is a very complicated process. If the renaturation conditions are not suitable, there will be mismatching of disulfide bonds in the molecule, and covalent or hydrophobic bonds between molecules will form aggregates. On the one hand, the specific activity of the recombinant protein will be reduced. rate, resulting in unqualified product quality, and at the same time, precipitation occurs, which affects the yield

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombination porcine interferon alpha1-Fc fusion protein as well as coding gene and expression method thereof
  • Recombination porcine interferon alpha1-Fc fusion protein as well as coding gene and expression method thereof
  • Recombination porcine interferon alpha1-Fc fusion protein as well as coding gene and expression method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Example 1 Recombinant porcine interferon α1-Fc fusion protein gene optimization design

[0067] According to the cDNA sequence (GenBank accession number: NM_214393.1) and pig IgG Fc fragment (Sus scrofa IgG heavy chain) cDNA sequence (GenBank accession number: In the hinge region, CH2 region and CH3 region of NM_213828.1), these two genes are directly fused and codon optimized to obtain the gene of the recombinant porcine interferon α1-Fc fusion protein of the present invention, as shown in SEQ ID No: 1 .

[0068] The following is the codon optimization of the recombinant porcine interferon α1-Fc fusion protein. The parameters before and after optimization are compared as follows:

[0069] 1. Codon Adaptation Index (CAI)

[0070] Depend on Figure 2-a It can be seen that before codon optimization, the codon adaptation index (CAI) of the recombinant porcine interferon α1-Fc fusion protein gene in Escherichia coli was 0.61. Depend on Figure 2-bIt can be seen that ...

Embodiment 2

[0081] Embodiment 2: The expression plasmid construction of recombinant porcine interferon α1-Fc fusion protein gene

[0082] The fragment synthesized from the optimized recombinant porcine interferon α1-Fc fusion protein gene (as shown in SEQ ID No: 1) was constructed into the pUC57 plasmid (provided by Nanjing GenScript Co., Ltd.) to obtain a long-term Save the plasmid and call it pUC57-pIFNα1-Fc plasmid. Using the pUC57-pIFNα1-Fc plasmid as a template, NdeI and XhoI restriction sites were introduced upstream and downstream, respectively, for PCR amplification. The primer sequences used are as follows:

[0083] Upstream primers:

[0084] P1: GGAATTCCATATGTGTGACCTGCCGCAAACG

[0085] Downstream primers:

[0086] P2: CCGCTCGAGTCATTTGCCCTGGGTTTTGGAG

[0087] The total volume of the reaction was 50 μL, in which 2.5 μL of each primer was added at a concentration of 10 μmol / L, and 1 μL of dNTP at a concentration of 10 mmol / L was added. The DNA polymerase used was Phusion High...

Embodiment 3

[0089] Example 3 High Expression and Identification of Recombinant Porcine Interferon α1-Fc Fusion Protein in Escherichia coli

[0090] Specific steps are as follows:

[0091] 1. The pET21b-pIFNα1-Fc plasmid with correct sequencing alignment in Example 2 was transformed into a competent strain of Escherichia coli BL21 (DE3) (purchased from Beijing Tiangen Biochemical Technology Co., Ltd.), and cultured overnight on an ampicillin plate at 37°C.

[0092] 2. On the second day, pick 1-4 recombinant colonies containing the pET21b-pIFNα1-Fc plasmid, insert them into LB culture medium (purchased from Amresco) containing 100 μg / mL ampicillin, and culture overnight at 37°C.

[0093] 3. Take 50 μL of the overnight culture in step 2, add 5 mL of LB culture solution containing 100 μg / mL ampicillin, and culture with shaking at 37°C.

[0094] 4. Measure the OD of the bacterial solution every 1 h after inoculation 600 value, to be OD 600 When =1.0, the expression was induced with 1 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a recombination porcine IFN (interferon) alpha1-Fc fusion protein as well as a coding gene and expression, purification and inclusion body renaturation methods of the recombination porcine IFN alpha1-Fc fusion protein. IFN alpha1 is the most common interferon and has remarkable anti-virus, anti-tumor, hematopoietic cell proliferation inhibition, immune adjustment functions and the like. But natural IFN alpha1 is expressed in an organism in a very small amount, lots of IFN alpha1 is difficult to directly extract in vivo for clinical research and application, and the defect of fast clearing speed of the IFN alpha 1 in blood plasma exists. Therefore, the invention provides the recombination porcine IFN alpha1-Fc fusion protein suitable for an escherichia coli prokaryotic expression system, wherein a porcine IFN alpha1 part is an entire sequence of a porcine IFN alpha1 extracellular region, an Fc fragment part comprises a hinge region, a CH2 region and a CH3 region of an antibody, and the porcine IFN alpha1 part and the Fc fragment part are directly fused. The fusion protein provided by the invention maintains the most of biological activity of the IFN alpha 1, the half-life period of the fusion protein is greatly prolonged, and conditions are provided for the industrialization of the fusion protein.

Description

technical field [0001] The invention belongs to the field of bioengineering genes, and relates to a recombinant porcine interferon α1-Fc fusion protein and its coding gene, as well as its expression, purification and inclusion body renaturation methods. Background technique [0002] Interferon (Interferon, IFN) is a group of active proteins (mainly glycoproteins) with multiple functions, and is a cytokine produced by monocytes and lymphocytes. They have broad-spectrum anti-virus, affect cell growth, differentiation, regulation of immune function and other biological activities on the same kind of cells. According to the source of IFN, that is, animal species, cell type, the nature of the inducer and the induction conditions, it can be divided into three types: α, β, and γ. Among them, IFN-α is a group of low-molecular-weight glycoproteins with similar structures and close functions produced by immune cells through antiviral responses. Among the many subtypes, interferon α1...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/63C12N15/70C12N1/21C12P21/02C07K1/14C12R1/19
Inventor马永王安良章成昌徐春林陈晨王耀方
OwnerGENSUN INST OF BIOMEDICINE