Unlock instant, AI-driven research and patent intelligence for your innovation.

Composition and method for site-specific recombination in hamster cells

A technology for hamster cells and host cells, applied in the field of genetic engineering, can solve problems rarely involved in screening stable and high-efficiency expression cell lines

Active Publication Date: 2013-09-18
ZHEJIANG ECHON BIOMEDICAL CO LTD
View PDF9 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, many expression vectors containing appropriate cis-acting elements and selectable markers have been successfully constructed, which can be conveniently used for the expression of foreign genes. However, the current research is mainly on how to use CHO cells to produce products, and there are few Research involving the screening of stable and highly expressive cell lines

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Composition and method for site-specific recombination in hamster cells
  • Composition and method for site-specific recombination in hamster cells
  • Composition and method for site-specific recombination in hamster cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0336] Embodiment 1: Construction of pRu vector

[0337] In this example, a pRu plasmid vector that can be used to insert homologous sites and foreign sequences (see Figure 11 , SEQ ID NO: 45). It contains three marker genes, RFP, ampicillin resistance gene and neomycin resistance gene, and promoters operably linked to these genes. When the homologous site is inserted, the pRu vector can be homologously recombined with the target site on the genome by the method of the present application, and the recombinant cells can be easily screened.

Embodiment 2

[0338] Embodiment 2: Construction of pCMV-RP vector

[0339] Using the genomic DNA of Escherichia coli as a template, the RecA gene was obtained by PCR using Phusion DNA polymerase (NEB Biolabs) and primers P1 and P2 as shown below:

[0340] P1: GACCGGCGCGCCGGATCCATGGCTATCGACGAAAACAAACAG (SEQ ID NO: 1);

[0341] P2: CACTGGACTAGTGGATCCTTAAAAATCTTCGTTAGTTTCTGCTACG (SEQ ID NO: 2).

[0342] The PCR product containing the RecA gene was cloned into the pROSE plasmid with the EGFP-puromycin-ubiquitin coding sequence removed ( Figure 12 , SEQ ID NO:46) at the BamH I restriction site, an expression vector containing the RecA gene was obtained and named pCMV-RP. The plasmid was sequenced to verify the insertion of the RecA gene. Amplify pCMV-RP to obtain the expression vector of the recombinase RecA, and purify it for future use.

Embodiment 3

[0343] Example 3: Construction of recombinant vectors containing iTS20 homology sites

[0344] In this example, the iTS20 high-expression site in the Chinese hamster ovary (CHO) genome was selected as the high-expression site, that is, the base sequence within 50 kb upstream or downstream of the Rpsa gene. use Figure 1t The Rpsa gene sequence in the mouse is searched for homology in the whole gene sequence of the mouse, and the mouse Rpsa gene homologous to the hamster Rpsa gene fragment is obtained, and then the sequence within 50kb upstream and downstream of the mouse Rpsa gene is known. According to the mouse DNA sequence within this range, primers are designed, and the genome material of the hamster is used as a template to amplify by PCR to obtain the sequence within 50kb upstream and downstream of the hamster Rpsa gene in the hamster genome. These sequences are the specific sequences of CHO-Genome.iTS 20, which can be used as high expression sites in the present inve...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a composition and a method for site-specific recombination in hamster cells, and particularly relates to a composition and a method for carrying out site-specific recombination on an exogenous sequence in a high-expression site of a target nucleotide sequence. The target nucleotide sequence can be a genome of hamster cells (such as Chinese hamster ovary cells, CHO cells). The invention also provides a host cell containing high-expression sites on chromosomes. The host cell contains the composition for site-specific recombination provided by the invention, or an exogenous sequence is subjected to site-specific recombination in a high-expression site of the composition.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a composition and method which can be used for gene recombination at a specific site in the hamster cell genome, and stable high-expressing cells produced thereby. Background technique [0002] Genetically engineered drugs, born in the late 1970s, have quickly become an eye-catching field in the pharmaceutical industry because of their incomparable advantages. According to the type of host cell, gene expression systems can be roughly divided into prokaryotic, yeast, plant, insect and mammalian cell expression systems. Compared with other systems, the mammalian cell expression system has the advantage of being able to guide the correct folding of proteins, and provide various post-translational processing functions such as complex N-type glycosylation and accurate O-type glycosylation. The structure, physical and chemical properties and biological functions are closes...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/113C12N5/10
Inventor 凌建群苏会敏姜超凤阁
Owner ZHEJIANG ECHON BIOMEDICAL CO LTD