Signal peptide-histone H1 fusion protein, and coding gene and application thereof
A fusion protein and signal peptide technology, applied in the biological field, can solve problems such as unreachable and unsatisfactory lysine content
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1, Fusion Protein Glutenin Signal Peptide-Histone H1 and the Acquisition of the Expression Vector Containing the Protein
[0040] 1. Design of primers
[0041] According to the relevant information of rice histone H1 (Histone H1, ACCESSION NM_001058108) gene coding sequence, two pairs of PCR primers were designed with Generunner software,
[0042] P(OSH11):GGATAGCGGCAGTAGTCAG, P(OSH12):CCTCCTCGCAACTAACAAC;
[0043] P(OSH13): GGCCCATGGCGACCGACGTGG, P(OSH14): CGTGAGCTCCTACTTCTTCGCCTTCCGG;
[0044] These two pairs of primers are used to clone the protein coding sequence of the rice histone H1 gene.
[0045]According to the information about the coding sequence of rice glutelin (ACCESSION NM_001071077) gene, the signal peptide sequence of rice glutelin was analyzed with signal peptide online analysis software (http: / / www.cbs.dtu.dk / services / SignalP / ). Design the oligonucleotide sequence encoding glutenin signal peptide according to the signal peptide sequence of ...
Embodiment 2
[0073] Example 2, Obtaining of Transgenic Rice Expressing Glutenin Signal Peptide-Histone H1
[0074] 1. Obtaining of transgenic Gt-Histone H1 rice
[0075]In this experiment, the gene encoding the fusion protein Gt-Histone H1 was introduced into the rice callus by expressing the glutenin signal peptide-histone H1 binary expression vector pTG-Gt-Histone H1 through the method mediated by Agrobacterium tumefaciens. , selection, regeneration, hardening and other stages to obtain transgenic rice seedlings. The specific steps are as follows:
[0076] 1. Cultivation of Agrobacterium tumefaciens in co-transformation of double bacteria
[0077] The binary expression vector pTG-Gt-Histone H1 was introduced into the Agrobacterium tumefaciens EHA105 (Tang Li, Liu Qiaoquan, Deng Xiaoxiang, Wu Xiaojin, Xin Shiwen. Indica rice restorer line transgenic for high lysine protein (LRP) gene without resistance selectable marker Obtained. Acta Crops, 2006, 32(8): 1248-1251.), the recombinant Ag...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 