Unlock instant, AI-driven research and patent intelligence for your innovation.

Signal peptide-histone H1 fusion protein, and coding gene and application thereof

A fusion protein and signal peptide technology, applied in the biological field, can solve problems such as unreachable and unsatisfactory lysine content

Inactive Publication Date: 2013-10-02
SHENZHEN GRADUATE SCHOOL TSINGHUA UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] There have been many researches on gene transformation of high-lysine protein, but the increase of lysine content is not ideal, and it cannot reach or be far below the level of 5.5g lysine per hectogram of protein stipulated by the World Health Organization (WHO). Further excavate and clone high-quality protein genes rich in lysine in rice to further increase the lysine in the protein-binding form, in order to obtain transgenic plants with lysine content reaching the WHO level

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Signal peptide-histone H1 fusion protein, and coding gene and application thereof
  • Signal peptide-histone H1 fusion protein, and coding gene and application thereof
  • Signal peptide-histone H1 fusion protein, and coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1, Fusion Protein Glutenin Signal Peptide-Histone H1 and the Acquisition of the Expression Vector Containing the Protein

[0040] 1. Design of primers

[0041] According to the relevant information of rice histone H1 (Histone H1, ACCESSION NM_001058108) gene coding sequence, two pairs of PCR primers were designed with Generunner software,

[0042] P(OSH11):GGATAGCGGCAGTAGTCAG, P(OSH12):CCTCCTCGCAACTAACAAC;

[0043] P(OSH13): GGCCCATGGCGACCGACGTGG, P(OSH14): CGTGAGCTCCTACTTCTTCGCCTTCCGG;

[0044] These two pairs of primers are used to clone the protein coding sequence of the rice histone H1 gene.

[0045]According to the information about the coding sequence of rice glutelin (ACCESSION NM_001071077) gene, the signal peptide sequence of rice glutelin was analyzed with signal peptide online analysis software (http: / / www.cbs.dtu.dk / services / SignalP / ). Design the oligonucleotide sequence encoding glutenin signal peptide according to the signal peptide sequence of ...

Embodiment 2

[0073] Example 2, Obtaining of Transgenic Rice Expressing Glutenin Signal Peptide-Histone H1

[0074] 1. Obtaining of transgenic Gt-Histone H1 rice

[0075]In this experiment, the gene encoding the fusion protein Gt-Histone H1 was introduced into the rice callus by expressing the glutenin signal peptide-histone H1 binary expression vector pTG-Gt-Histone H1 through the method mediated by Agrobacterium tumefaciens. , selection, regeneration, hardening and other stages to obtain transgenic rice seedlings. The specific steps are as follows:

[0076] 1. Cultivation of Agrobacterium tumefaciens in co-transformation of double bacteria

[0077] The binary expression vector pTG-Gt-Histone H1 was introduced into the Agrobacterium tumefaciens EHA105 (Tang Li, Liu Qiaoquan, Deng Xiaoxiang, Wu Xiaojin, Xin Shiwen. Indica rice restorer line transgenic for high lysine protein (LRP) gene without resistance selectable marker Obtained. Acta Crops, 2006, 32(8): 1248-1251.), the recombinant Ag...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a signal peptide-histone H1 fusion protein, and a coding gene and application thereof. The fusion protein is a protein obtained by fusing glutelin 1 signal peptide and histone H1, and is (a), a protein consisting of an amino acid sequence shown as a sequence 2 in a sequence table or (b), a protein which is obtained by substituting, and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown as the sequence 2 in the sequence table, is related to the quality of a plant seed, and is derived from the sequence 2. Experiments show that a glutelin 1 signal peptide-histone H1 fusion gene is generated by connecting a glutelin 1 signal peptide coding sequence with a histone H1 gene coding sequence, and is introduced into a wild rice callus, an expression for transgenic rice is obtained, and the lysine content of a transgenic rice seed is higher than that of wild rice.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a signal peptide-histone H1 fusion protein and its coding gene and application. Background technique [0002] Lysine is called "the first essential amino acid" and plays an important role in the metabolism of living organisms. Lysine is an essential amino acid for humans and monogastric animals, and is the most deficient amino acid in the seeds of cereal crops that are a staple food for humans and a source of feed for livestock. It is extremely difficult to improve the nutritional quality of rice, especially the content of protein and lysine, through traditional breeding methods. Using transgenic technology, the fusion protein gene rich in lysine is introduced into high-yielding rice varieties to achieve high-efficiency expression of high-quality protein genes, which can change the low content of essential amino acids in rice, which is beneficial to public health and people's daily ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21A01H5/00
Inventor 武小金谢振华田继微张创孟祥伦
Owner SHENZHEN GRADUATE SCHOOL TSINGHUA UNIV