Noninvasive detection kit for Hashimoto's thyroiditis genes
A technology for Hashimoto's thyroiditis and a kit, applied in the field of molecular biology, can solve problems such as reduced transcriptional activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0021] Example 1. Use of detection kits
[0022] 1. Extract DNA template
[0023] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.
[0024] 2. PCR amplification reaction
[0025] Use the PCR reaction component in the detection kit, which contains the following primer pairs:
[0026] (1) CTLA4 (A49G) forward primer: 5'CTGAACACCGCTCCCATAAA3'
[0027] CTLA4 (A49G) reverse primer: 5'GAATACAGAGCCAGCCAAGC3'
[0028] (2) IL-4 (C-509T) forward primer: 5'CCTGCTGGGACCCAAACTA3'
[0029] IL-4 (C-509T) reverse primer: 5'ACAGGTGGCATCTTGGAAAC5'
[0030] The reaction system for PCR amplification is: 10×PCR reaction buffer 2.5ml; 25mM dNTP mixture 0.2ml, 5U / ul Taq enzyme 0.125ml, DNA template 1ml (about 12-15ng), 20uM forward primer and reverse primer Each 0.25ml, ddH2O 19.175ml;
[0031] The reaction conditions are: 94°C for 4 minutes for denaturation and enzyme activation, 94°C for 30 seconds for d...
Embodiment 2
[0044] Example 2. The service of Hashimoto's thyroiditis gene detection for the crowd
[0045] 1. Sampling and DNA extraction
[0046] The physicians in the laboratory department of the hospital instructed the subjects to use oral swabs to sample oral epithelial cells, and the phenol-chloroform method was used to extract DNA from oral epithelial cells.
[0047] 2. Genotype detection
[0048] Using the kit provided by the present invention, carry out DNA sequencing on the two single nucleotide polymorphism sites of A49G on the CTLA4 gene and C-509T on the IL-4 gene of the subject's genomic DNA, and determine the two SNPs The genotype of the locus.
[0049] 3. Risk assessment and analysis of Hashimoto's thyroiditis high-risk population
[0050] Through the analysis of the SNPs genotype of the subjects, a Hashimoto's thyroiditis risk assessment analysis report is issued. The report details the SNP site genetic detection information of A49G on the CTLA4 gene and C-509T on the IL...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More