Quantitative polymerase chain reaction (PCR) method capable of improving sensitivity and specificity
A specific and sensitive technology, applied in the field of quantitative PCR, to achieve the effect of good specificity, convenient use and good versatility
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] One, the reagent of the quantitative PCR reaction system of the present embodiment is as follows:
[0026] 10×Buffer (Mg 2+ free);
[0027] 10×Gelgreen I;
[0028] 10×PCR protectant (fetal bovine serum albumin);
[0029] Each 10mmol / L solution of dATP, dUTP, dGTP and dCTP;
[0030] 25mmol / L Mg 2+ ;
[0031] 5U / μL hTaq enzyme;
[0032] Sterile double distilled water.
[0033] Two, the application of the quantitative PCR method of this embodiment
[0034] (1) Preparation of DNA to be tested: DNA was extracted from mouse blood according to conventional methods, and EGF gene was amplified.
[0035] (2) Synthesis of primers.
[0036] Forward primer: TATAGATATCATGAATAGTTATCCAGGATGCCCA
[0037] Reverse primer: TATA GAATTCTCAACGCAGTTCCCCACCATCGTAG.
[0038] (3) The establishment of the PCR reaction system, the total reaction volume is 25 μL, and the reagents are added according to the table below.
[0039] Table 1 PCR reaction system
[0040] .
[0041] (4) qPC...
Embodiment 2
[0050] The reagents of the quantitative PCR reaction system of the present embodiment are as follows:
[0051] 10×Buffer (Mg 2+ free);
[0052] 10×Gelgreen I;
[0053] 10×PCR protectant (Tween 20);
[0054] Each 5mmol / L solution of dATP, dUTP, dGTP and dCTP;
[0055] 20mmol / L Mg 2+ ;
[0056] 5U / μL hTaq enzyme;
[0057] 10 μmol / L forward primer;
[0058] 10μmol / L reverse primer;
[0059] Sterile double distilled water.
[0060] The working concentration of the fluorescent dye Gelgreen I is 0.5ט1×. The working concentration of the hot start hTaq enzyme is 0.01-0.1 U / μL. The working concentration of the dATP solution, dUTP solution, dGTP solution or dCTP solution is 100-200 μmol / L.
[0061] Prepare the DNA to be tested according to the conventional method, establish the PCR reaction system, and carry out the qPCR reaction.
Embodiment 3
[0063] The reagents of the quantitative PCR reaction system of the present embodiment are as follows:
[0064] 10×Buffer (Mg 2+ free);
[0065] 10×Gelgreen I;
[0066] 10×PCR protectant (dithiothreitol);
[0067] Each 10mmol / L solution of dATP, dUTP, dGTP and dCTP;
[0068] 30mmol / L Mg 2+ ;
[0069] 5U / μL hTaq enzyme;
[0070] 10 μmol / L forward primer;
[0071] 10μmol / L reverse primer;
[0072] Sterile double distilled water.
[0073] The working concentration of the fluorescent dye Gelgreen I is 0.5ט1×. The working concentration of the hot start hTaq enzyme is 0.01-0.1 U / μL. The working concentration of the dATP solution, dUTP solution, dGTP solution or dCTP solution is 100-200 μmol / L.
[0074] Prepare the DNA to be tested according to the conventional method, establish the PCR reaction system, and carry out the qPCR reaction.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 