Recombinant neutrophil gelatinase associated lipocalin and preparation method of protein antibody

A technology of lipocalin and neutrophils, which is applied in the field of biological science and carrier protein, can solve the problems of low expression yield, poor specificity and sensitivity, and insufficient polyclonal antibody, so as to increase the expression level and avoid poor specificity , the effect of sufficient amount of resistance

Active Publication Date: 2013-12-18
CUSABIO TECH LLC
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the specificity and sensitivity of these existing antibodies are relatively poor. Most of the expressed protein sequences use full-length sequences. The expression yield of full-length sequences is low, which easily leads to insufficient preparation of polyclonal antibodies, thereby limiting the development and production of the detection index kit. Large-scale promotion and application affect the quality of kits

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant neutrophil gelatinase associated lipocalin and preparation method of protein antibody
  • Recombinant neutrophil gelatinase associated lipocalin and preparation method of protein antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] 1. Expression of recombinant NGAL

[0031] 1. The sequence of SEQ ID NO.1 in the clone sequence table, the primers used are:

[0032] Upstream primer: 5'TACGGGATCCGCCCTGTTGGGGGCTCTGCATG3' (SEQ ID NO.2)

[0033] Downstream primer: 5'GCTAGTCGACGCCGTCGATACACTGGTCG3' (SEQ ID NO.3)

[0034] This primer pair was used to amplify the recombinant NGAL fragment sequence in SEQ ID NO.1 in vitro.

[0035] 2. Insert the amplified recombinant NGAL fragment in SEQ ID NO. 1 into the expression vector pFastBacTM Dual. First, digest the pFastBacTM Dual plasmid with BamHI and SalI to expose the cohesive ends that can be paired with the NGAL fragment, and then form a complete circular plasmid under the action of ligase. Then the circular plasmid was transformed into E. coli DH5α.

[0036] 3. Plasmid verification. After obtaining Amp-resistant transformants, 10 transformants were picked and cultured in LB medium containing 100 μg / mL Amp overnight, the plasmid was extracted, and the plasmid DNA was ...

Embodiment 2

[0052] This example is different from Example 1 in that the antibody preparation steps are different from Example 1. The antibody preparation steps are:

[0053] Antibody preparation

[0054] Immune goats with the protein obtained by separation and purification to prepare anti-recombinant NGAL polyclonal antibodies. The specific operation process is as follows: ① Male healthy young Boer goats, weighing more than 15KG, are randomly divided into groups, waiting to be immunized. One week before immunization, blood was collected from the jugular vein as a negative control; ②A certain amount of recombinant NGAL protein powder was prepared with sterile PBS buffer to make a solution with a concentration of 1 mg / mL and fully emulsified with the same amount of Freund’s complete adjuvant Inject the white rabbits prepared in advance for immunization, the injection volume is 0.6-0.8mg / head; ③Inject a booster injection three weeks after the first immunization injection, and then boost immuniza...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombinant neutrophil gelatinase associated lipocalin and a preparation method thereof. The preparation method of the recombinant neutrophil gelatinase associated lipocalin antibody belonging to the technical fields of biological science and transthyretin comprises the following steps: analyzing an NGAL (neutrophil gelatinase associated lipocalin) epitope; synthesizing the recombinant NGAL; separately purifying the recombinant NGAL; preparing an anti-rabbit recombinant NGAL antibody; collecting and separating to obtain an antiserum purified antibody containing the antibody, so as to obtain the anti-NGAL antibody. By adopting the preparation method, the problem of low yield in preparation of a multi-antibody by a natural full-length protein is solved; meanwhile, the antibody prepared by the preparation technology disclosed by the invention has good specificity; the problem that the traditional neutrophil gelatinase associated lipocalin antibody cannot completely meet a western blot immunohistochemical experiment and an enzyme-linked immunosorbent assay is also solved.

Description

Technical field [0001] The invention belongs to the field of biological sciences and carrier protein technology, and particularly relates to a recombinant neutrophil gelatinase-related lipocalin and a method for preparing a recombinant neutrophil gelatinase-related lipocalin antibody. Background technique [0002] Neutrophil gelatinase-associated lipocalin (NGAL), also known as human lipocalin 2 or ferritin, was first discovered in neutrophils by Kjeldsen et al. in 1993. Under physiological conditions, neutrophils, renal tubular epithelial cells, alveolar macrophages, bronchial epithelial mucous cells, etc. secrete a small amount of NGAL, while the brain and peripheral nerves, colon, uterus and ovaries, placenta, thyroid and other tissue cells secrete NGAL. The expression was negative. [0003] The physiological functions of NGAL are not yet fully understood. It may be involved in different physiological and pathological processes, involving embryonic development, cell differentia...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C07K16/18C07K16/06
Inventor华权高刘瑾易汪雪闫彩霞马峰沈鹤霄舒芹
OwnerCUSABIO TECH LLC