A construction method for producing coenzyme q10 engineering bacteria, engineering bacteria and application thereof

A technology of engineering bacteria and coenzymes, applied in the biological field, to achieve high synthesis capacity, reduce production costs, and increase production

Active Publication Date: 2016-09-28
ZHEJIANG NHU CO LTD +1
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no patent on enhancing the synthesis ability of coenzyme Q10 of Rhodobacter sphaeroides through gene overexpression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1 produces the construction method of the engineering bacterium of coenzyme Q10

[0035] 1. Construction of recombinant plasmids

[0036] 1. Design primers. Primer sequences were designed using Primer5 primer design software.

[0037] Clone gene DXS, where,

[0038] Upstream primer DXSF:

[0039] CATGCCATGGGCATGACCGACAGACCCTGCAC;

[0040] Downstream primer DXSR: CGGGATCCCTCCTCCGGATCAGGCGCG;

[0041] The upstream primer added restriction site NcoI, and the downstream primer added restriction site BamHI.

[0042] Clone the gene DDSF:

[0043] Upstream primer DDSF:

[0044] GAAGATCTGAGGAGACGGGATGGGATTGGACGAGGTT;

[0045] Downstream primer DDSR:

[0046] CCCAAGCTTGAAAGGGATCAGGCGATGCG;

[0047] The upstream primer contains restriction site BglII and SD sequence GAGGAGA, and the downstream primer contains restriction site HindIIII.

[0048]2. Extract the genomic DNA of Rhodobacter sphaeroides (all the reagents used are from the Biospin Bacterial Genomic ...

Embodiment 2

[0128] Example 2: IPTG induced expression

[0129] 1. Pick a single clone of the NHU-ZDD strain and inoculate it in a 50mL shake flask containing 10mL of seed medium, at a rotation speed of 200rpm, and cultivate it at 30°C for 23h to obtain first-grade seeds;

[0130] 2. Transfer the first-grade seeds to a 50mL shake flask containing 20mL seed medium at a ratio of 1%, and cultivate them at 30°C and 200rpm for 23 hours to obtain second-grade seeds;

[0131] 3. Inoculate the secondary seeds into 500mL containing 100mL fermentation medium at a ratio of 1%. After culturing for 72 hours at 30°C and 200rpm, add IPTG to a final concentration of 1mM (0.001mM or 10mM is also optional) Induce expression for 48h. Collect the bacterial fluid. And the coenzyme Q10 in it is extracted by conventional methods.

[0132] Each 100mL of seed medium contains: (NH 4 ) 2 SO 4 0.25g, corn steep liquor 0.05g, yeast extract 0.14g, NaCl 0.2g, glucose 0.3g, K 2 HPO 4 0.05g, KH 2 PO 4 0.05g, Mg...

experiment example

[0134] Experimental example: HPLC detection and comparison of coenzyme Q10 production under the same culture conditions before and after strain transformation, see Table 1:

[0135] Table 1 Comparison of coenzyme Q10 production before and after strain transformation

[0136] strain type

[0137] From the above table, the coenzyme Q10 output of the transformed strain increased from 2500mg / L to 3200mg / L.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the field of biotechnology, and discloses a construction method for producing coenzyme Q10 engineering bacteria, engineering bacteria and applications thereof. The bacteria is Rhodobacter sphaeroides with a Latin name Rhodobacter sphaeroides ; Named as NHU-ZDD strain; Deposit unit: General Microorganism Center of China Microbiological Culture Collection Management Committee; Preservation time: April 13, 2012; Preservation number: CGMCC No.5998. The invention provides a method for improving the production of coenzyme Q10 by modifying the metabolic pathway related to the EMP pathway, which can increase the synthesis ability of coenzyme Q10 by about 30%, and is suitable for large-scale industrial production of coenzyme Q10.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a construction method for producing coenzyme Q10 engineering bacteria, engineering bacteria and applications thereof. Background technique [0002] Coenzyme Q is a fat-soluble quinone compound that widely exists in organisms. Coenzyme Q from different sources has different numbers of isopentenyl units in its side chain. Humans and mammals have 10 isopentenyl units, so it is called coenzyme Q10. [0003] Coenzyme Q10 is an important hydrogen transporter in the respiratory chain of biological cells and a good biochemical drug. In recent years, it has been widely used in the treatment of various diseases such as heart disease, diabetes, cancer, acute and chronic hepatitis, and Parkinson's disease. In addition, it also has significant effects in treating scurvy, duodenal ulcer, necrotizing periodontitis, and promoting pancreatic function and secretion. Recently, researchers have discove...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/20C12N15/09C12P7/66C12R1/01
Inventor 于洪巍石一军陆文强王昌泽张建新
Owner ZHEJIANG NHU CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products