A kind of primer, method and kit for detecting hbv telbivudine resistance mutation

A drug-resistant mutation, telbivudine technology, applied in the field of medical testing, can solve problems such as failure to detect HBV polymerase region gene mutation in time, low success rate of hepatitis B virus sample amplification, delay in optimal treatment period, etc. Eliminates the link of conditional exploration, improves the success rate of amplification, and has the effect of high degree of automation

Active Publication Date: 2015-11-11
CHANGSHA ADICON CLINICAL LAB
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, the primers and detection methods currently used in PCR detection have a low success rate and low specificity for the amplification of low-copy HBV samples, which leads to the inability to detect HBV polymerase in time when telbivudine is used in the antiviral treatment of hepatitis B patients. The region gene has mutated, reminding the doctor that the patient will or has developed drug resistance to LdT during the treatment with telbivudine, and needs to change the drug or adopt other treatment methods
If drug resistance due to gene mutations in the HBV polymerase region cannot be detected in time, the best treatment period will be delayed and the condition will worsen

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of primer, method and kit for detecting hbv telbivudine resistance mutation
  • A kind of primer, method and kit for detecting hbv telbivudine resistance mutation
  • A kind of primer, method and kit for detecting hbv telbivudine resistance mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] A primer for detecting HBV telbivudine drug-resistant mutation, the design of the primer is two pairs of specific amplification primers designed for regions with high homology among different subtypes of HBV, including:

[0053] (i) Specific outer amplification primers:

[0054] SEQ NO1: GACTCGTGGTGGACTTCTCTC;

[0055] SEQNO2: CKTTGACATACTTTCCAATCAA; wherein K represents G or T;

[0056] (ii) Specific inner amplification primers:

[0057] SEQ NO 3: TCGTGGTGGACTTCTCTCAATT;

[0058] SEQ NO 4: TTCGTTGACATACTTTTCCAATCA;

[0059] The specific inner amplification primers SEQNO3 and SEQNO4 can also be used as sequencing primers for Sanger sequencing.

[0060] The method for detecting the HBV telbivudine drug-resistant mutation using the above primers comprises the following steps:

[0061] (i) Extract the HBV DNA in the serum of the sample.

[0062] (ii) Using HBV DNA as a template, perform the first round of PCR amplification according to the specific outer amplificatio...

Embodiment 2

[0080] Embodiment 2: detection method

[0081] 1. Use the conventional phenol / chloroform extraction method to extract the HBVDNA in the sample serum.

[0082] 2. The first round of PCR amplification method is as follows:

[0083] The total PCR system for one sample is 10 μl: 10*PCRBuffer 1 μl, dNTP 1 μl, primers SEQNO 10.4 μl, SEQNO 20.6 μl, sterilized water 5.8 μl, Taq enzyme 0.2 μl, HBV DNA template 1 μl.

[0084] The first round of PCR reaction procedure:

[0085]

[0086] 3. The second round of PCR amplification method is as follows:

[0087] The total PCR system for one sample is 20 μl: 10*PCRBuffer 2 μl, dNTP 2 μl, primers SEQNO3 1.2 μl, SEQNO4 1 μl, sterilized water 12.3 μl, Taq enzyme 0.5 μl, first-round product 1 μl.

[0088] The second round of PCR reaction procedure:

[0089]

[0090] 4. Enzyme purification of PCR products. The enzyme purification system for a sample is 11 μl: calf alkaline phosphatase (CIAP) 0.1 μl, exonuclease Exo I 0.5 μl, sterilized...

Embodiment 3

[0097] Embodiment 3: sample detection

[0098] 30 samples of HBV infection were detected according to the methods of Examples 1 and 2. Results showed that all samples were successfully amplified (see Figure 2-3 ), and all samples were successfully sequenced to obtain the gene information of 180 and 204 sites (see Table 1).

[0099] For those skilled in the field of biomedicine, according to the sequencing map (attached Figures 6 to 11 ) to determine whether the new primers for detecting the mutation information at positions 180 and 204 are effective.

[0100] Table 1

[0101] sample number rtL180M rtM204I rtM204V 201 none none none G113 have have none G13 have none have 101 have none have T113 none have none T310 have none have 115 have none have 102 none have none 4 have have none T314 none none none 305 none have none 114 have none ha...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of medical testing, and specifically relates to a primer, a method and a kit for detecting HBV telbivudine drug-resistant mutations, including: (i)? Outside-specific amplification primer: SEQ? NO1 and SEQ? NO2; (ii)? Inside-specific amplification primer: SEQ? NO3 and SEQ? NO4, and can be used as a sequencing primer for Sanger sequencing. The method of the present invention designs specific amplification primers and uses nested PCR to amplify, and the PCR product is subjected to enzyme purification and sequence reaction to obtain 180 and 204 nucleotide site information. In addition, the primers of the present invention can simultaneously detect two mutations of 180 and 204 nucleotides at one time, have the characteristics of high specificity, high accuracy, and high sensitivity, and are suitable for clinical detection of telbivudine drug-resistant mutations.

Description

technical field [0001] The invention belongs to the field of medical testing, and in particular relates to a primer, a detection method and a kit for highly sensitive detection of HBV telbivudine drug-resistant mutation. Background technique [0002] Hepatic inflammation and necrosis caused by the continuous replication of HBV virus is a key factor in the occurrence and development of the disease. my country's "Guidelines for the Prevention and Treatment of Chronic Hepatitis B" emphasizes the importance of antiviral treatment: antiviral treatment is the key, as long as there are indications and conditions permit, standardized antiviral treatment should be carried out. [0003] Nucleoside (acid) analogs of antiviral drugs mainly include lamivudine, adefovir, telbivudine (LdT), entecavir and tenofovir. Among them, LdT is a L-nucleoside drug with a strong and specific effect on inhibiting hepatotropic virus, and its effect on HBV replication is stronger than that of lamivudine...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
CPCC12Q1/6848C12Q1/686C12Q1/6888C12Q2549/119C12Q2600/106C12Q2600/156C12Q2531/113
Inventor陈奕磊周晓犊王淑一
OwnerCHANGSHA ADICON CLINICAL LAB