Preparation and application methods of genetically engineered bacterium expressing thymosin beta4

A technology of genetically engineered bacteria and thymosin, applied in the direction of hormone peptides, the use of carriers to introduce foreign genetic materials, animal/human proteins, etc., can solve the problems of high cost and many types of impurities of thymosin β4, and achieve low cost and high purification process Simple, cost-effective and environmentally friendly

Inactive Publication Date: 2014-03-05
SHANGHAI ENTS BIOTECH
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, the cost of solid-phase synthesis of thymosin β4 is also high, and there are many types of impurities

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation and application methods of genetically engineered bacterium expressing thymosin beta4
  • Preparation and application methods of genetically engineered bacterium expressing thymosin beta4
  • Preparation and application methods of genetically engineered bacterium expressing thymosin beta4

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0017] The method for preparing a genetically engineered bacterium expressing thymosin β4 provided by the present invention comprises the following steps: step 1, synthesizing a thymosin β4 (Tβ4) gene sequence that can be highly expressed in Escherichia coli; step 2, converting the gene obtained in step 1 Recombine into the pTWIN 1 plasmid vector digested with shrimp alkaline phosphatase I (Sap I) to obtain the pTWIN-Tβ4 fusion vector; step 3, use the pTWIN-Tβ4 obtained in step 2 as a template, and PCR amplify the vector on the vector Containing the peptide sequence and Tβ4 sequence; step 4, recombining the gene sequence obtained in step 3 into the plasmid pET-28a digested with restriction enzymes Nco I and Xho I to obtain the pET-Tβ4 expression vector; step 5, recombining The pET-Tβ4 obtained in step 4 is transformed into competent Escherichia coli cells BL21 to obtain the pET-Tβ4 engineering bacteria; in step 6, the OD of the pET-Tβ4 engineering bacteria liquid is 600 At a v...

Embodiment 1

[0020] 1. Acquisition of thymosin β4 gene.

[0021] According to the sequence published by NCBI (NM_021109.3) and the preferred codons of Escherichia coli, the thymosin β4 gene sequence that can be highly expressed in Escherichia coli was designed, and the following two single strands were synthesized by Gene Synthesis Company.

[0022] Single Chain 1:

[0023] TCTGACAAACCCGATATGGCTGAGATCGAGAAATTCGATAAGTCGAAACTGAAGAAGACAGAGACGCAAGAGAAAAATCCACTGCCTTCCAAAGAAACGATTGAACAGGAGAAGCAAGCAGGCGAATCG.

[0024] Single chain 2:

[0025] CGATTCGCCTGCTTGCTTCTCCTGTTCAATCGTTTCTTTGGAAGGCAGTGGATTTTTCTCTTGCGTCTCTGTCTTTCAGTTTCGACTTATCGAATTTCTCGATCTCAGCCATATCGGGTTTGTCAGA.

[0026] After synthesis, the two single strands were annealed at 55°C for 30 minutes to obtain the whole gene of thymosin β4.

[0027] 2. Construction of fusion vector pTWIN-Tβ4.

[0028] The pTWIN 1 plasmid was digested with Sap I and recovered by tapping the gel. The Tβ4 gene was ligated with the pTWIN 1 plasmid according t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses preparation and application methods of a genetically engineered bacterium expressing thymosin beta4. The preparation method comprises the following steps: S1, synthesizing a gene sequence of the thymosin beta4 which can be efficiently expressed in escherichia coli; S2, recombining the obtained gene into a SapI digested pTWIN1 plasmid vector to obtain a pTWIN-Tbeta4 fusion vector; S3, by taking the pTWIN-Tbeta4 as a template, carrying out PCR (Polymerase Chain Reaction) amplification on a contained peptide sequence and a Tbeta4 sequence on the vector; S4, recombining the obtained gene sequence to NcoI and XhoI digested plasmid pET-28a to obtain a pET-Tbeta4 expression vector; S5, converting the obtained vector to a competent escherichia coli cell BL21 to obtain a pET-Tbeta4 engineering bacterium; and S6, adding IPTG (Isopropyl-beta-D-Thiogalactoside) to induce Tbeta4 to express when the OD600 value of the obtained bacterial liquid is 0.4-0.6. The invention further discloses an application method of the genetically engineered bacterium expressing the thymosin beta4. The preparation and application methods of the genetically engineered bacterium expressing the thymosin beta4 provided by the invention lay a foundation for environment-friendly production of the thymosin beta4 with a low cost.

Description

technical field [0001] The invention relates to a preparation and application method of a genetic engineering bacterium, in particular to a preparation and application method of a genetic engineering bacterium expressing thymosin β4. Background technique [0002] Thymosin β4 (Thymosin beta 4, Tβ4) is an acidic polypeptide composed of 43 amino acids, the amino group of the first amino acid Ser at the N-terminus is modified by acetylation, and there is no disulfide bond. Its amino acid sequence is as follows: Ac-Ser-Asp-Lys-Pro-Asp-Met-Ala-Glu-Ile-Glu-Lys-Phe-Asp-Lys-Ser-Lys-Leu-Lys-Lys-Thr-Glu-Thr - Gln-Glu-Lys-Asn-Pro-Leu-Pro-Ser-Lys-Glu-Thr-Ile-Glu-Gln-Glu-Lys-Gln-Ala-Gly-Glu-Ser. Thymosin β4 has a molecular weight of 4964Da and an isoelectric point of 5.1. [0003] Thymosin β4 is a multifunctional factor that can regulate the polymerization and depolymerization of actin, and can promote skin wound healing, corneal injury repair, nerve injury repair, anti-inflammation, pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C07K14/575
Inventor李敏陈福鼎
OwnerSHANGHAI ENTS BIOTECH