Preparation and application methods of genetically engineered bacterium expressing thymosin beta4
A technology of genetically engineered bacteria and thymosin, applied in the direction of hormone peptides, the use of carriers to introduce foreign genetic materials, animal/human proteins, etc., can solve the problems of high cost and many types of impurities of thymosin β4, and achieve low cost and high purification process Simple, cost-effective and environmentally friendly
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0017] The method for preparing a genetically engineered bacterium expressing thymosin β4 provided by the present invention comprises the following steps: step 1, synthesizing a thymosin β4 (Tβ4) gene sequence that can be highly expressed in Escherichia coli; step 2, converting the gene obtained in step 1 Recombine into the pTWIN 1 plasmid vector digested with shrimp alkaline phosphatase I (Sap I) to obtain the pTWIN-Tβ4 fusion vector; step 3, use the pTWIN-Tβ4 obtained in step 2 as a template, and PCR amplify the vector on the vector Containing the peptide sequence and Tβ4 sequence; step 4, recombining the gene sequence obtained in step 3 into the plasmid pET-28a digested with restriction enzymes Nco I and Xho I to obtain the pET-Tβ4 expression vector; step 5, recombining The pET-Tβ4 obtained in step 4 is transformed into competent Escherichia coli cells BL21 to obtain the pET-Tβ4 engineering bacteria; in step 6, the OD of the pET-Tβ4 engineering bacteria liquid is 600 At a v...
Embodiment 1
[0020] 1. Acquisition of thymosin β4 gene.
[0021] According to the sequence published by NCBI (NM_021109.3) and the preferred codons of Escherichia coli, the thymosin β4 gene sequence that can be highly expressed in Escherichia coli was designed, and the following two single strands were synthesized by Gene Synthesis Company.
[0022] Single Chain 1:
[0023] TCTGACAAACCCGATATGGCTGAGATCGAGAAATTCGATAAGTCGAAACTGAAGAAGACAGAGACGCAAGAGAAAAATCCACTGCCTTCCAAAGAAACGATTGAACAGGAGAAGCAAGCAGGCGAATCG.
[0024] Single chain 2:
[0025] CGATTCGCCTGCTTGCTTCTCCTGTTCAATCGTTTCTTTGGAAGGCAGTGGATTTTTCTCTTGCGTCTCTGTCTTTCAGTTTCGACTTATCGAATTTCTCGATCTCAGCCATATCGGGTTTGTCAGA.
[0026] After synthesis, the two single strands were annealed at 55°C for 30 minutes to obtain the whole gene of thymosin β4.
[0027] 2. Construction of fusion vector pTWIN-Tβ4.
[0028] The pTWIN 1 plasmid was digested with Sap I and recovered by tapping the gel. The Tβ4 gene was ligated with the pTWIN 1 plasmid according t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 