LAMP (Loop-Mediated Isothermal Amplification) kit for detecting main subtype avian leukemia virus
A technology of avian leukosis virus and a kit, which is applied in the field of detection of avian leukosis virus, can solve problems such as aerosol pollution, inability to determine accurate detection results, etc., and achieve the effect of rapid detection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0021] 1. Preparation of materials
[0022] Avian leukosis virus A subtype, B subtype, E subtype and J subtype are all preserved by the poultry disease room of Guangxi University. The LAMP method DNA amplification kit (loopamp DNA amplification kit) was purchased from Beijing Lanpu Biotechnology Co., Ltd.
[0023] 2. Design and synthesis of LAMP primers
[0024] According to the POL gene sequence of avian leukosis virus in GenBank, a set of LAMP primers was designed by using the LAMP method primer-assisted design software PrimerExplorer V4 software, wherein F3 / B3 are outer primers and FIP / BIP are inner primers, as follows:
[0025] The sequence of the internal primer FIP is CTACATTAGTGGGCGCTGTCGGAACAACTGGAAGCACGCG (see the sequence listing SEQ.ID.No.1),
[0026] The sequence of the internal primer BIP is TCAAGATGGGACAGGAGGGAGTTTTGGCTTAACGCATCCTCT (see SEQ.ID.No.2 in the sequence listing);
[0027] The sequence of the outer primer F3 is TGATTTGGGGGCAAGTGTAC (see SEQ.ID.No.3 ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



