Unlock instant, AI-driven research and patent intelligence for your innovation.

Use of human ifitm3 gene and related medicines

A technology of use and gene expression, applied in the use of human IFITM3 gene and its related pharmaceutical fields, and can solve the problem that the expression situation has not been reported.

Active Publication Date: 2018-03-27
SHANGHAI GENBASE BIOTECH CO LTD
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, the expression of IFITM3 gene in tumor cells other than colon cancer has not been reported. Therefore, it is necessary to further study the role of IFITM3 gene in the malignant proliferation of tumor cells other than colon cancer and the molecular mechanism affecting the proliferation of tumor cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Use of human ifitm3 gene and related medicines
  • Use of human ifitm3 gene and related medicines
  • Use of human ifitm3 gene and related medicines

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0077] Example 1 Preparation of RNAi lentivirus against human IFITM3 gene

[0078] 1. Screening for effective siRNA targets against the human IFITM3 gene

[0079] Get IFITM3 (NM021034.2) gene information from Genbank; design effective siRNA targets for IFITM3 gene by using the design software Genechem of Shanghai Jikai Gene Chemical Technology Co., Ltd. In the coding sequence (CDS) region of the IFITM3 gene, a sequence of 21 bases was obtained starting from every other base, and Table 1 lists 12 effective siRNA target sequences for the IFITM3 gene.

[0080] Table 1 siRNA target sequence targeting human IFITM3 gene

[0081] SEQ ID NO

TargetSeq

start site

1

CCTGTTCAACACCCCTCTTCAT

284

2

GCTTCATAGCATTCGCCTACT

322

3

CCTGAACATCTGGGCCCTGAT

416

4

CCTCATGACCATTCTGCTCAT

446

5

CAGTGCTGATCTTCCAGGCCT

475

6

GTGCTGATCTTCCAGGCCTAT

477

7

GATCTTCCAGGCCTATGGATA

482

8

ATCTTCCAGGC...

Embodiment 2

[0105] Example 2 Real-time fluorescent quantitative RT-PCR method to detect the silencing efficiency of IFITM3 gene

[0106] Human breast cancer MCF-7 cells in the logarithmic growth phase were trypsinized to make a cell suspension (the number of cells was about 5×10 4 / ml) were seeded in 6-well plates and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, MCF-7:20) value, an appropriate amount of the virus prepared in Example 1 was added, the culture medium was replaced after 24 hours of culture, and the cells were collected after the infection time reached 5 days. Total RNA was extracted according to the instruction manual of Invitrogen's Trizol. According to Promega's M-MLV operating instructions, RNA was reverse-transcribed to obtain cDNA (see Table 6 for the reverse transcription reaction system, react at 42°C for 1h, and then bathe in a water bath at 70°C for 10min to inactivate reverse transcriptase).

[0107] Real-t...

Embodiment 3

[0113] Example 3 Detection of proliferation ability of tumor cells infected with IFITM3-siRNA lentivirus

[0114] Human breast cancer MCF-7 cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were seeded in 6-well plates and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, MCF-7:20), an appropriate amount of virus was added, and the culture medium was replaced after 24 hours of culture. After the infection time reached 5 days, the cells in each experimental group in the logarithmic growth phase were collected. The complete medium was resuspended into a cell suspension (2×10 4 / ml), inoculate a 96-well plate at a cell density of about 2000 cells / well. 5 replicate wells in each group, 100 μl per well. After laying the board, place at 37°C, 5% CO 2 Incubator cultivation. From the second day after plating, the plate was detected and read once ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses use and a related medicine of a human IFITM3 gene and discloses use of the human IFITM3 gene in tumor treatment, tumor diagnose and medicine preparation. The invention further constructs a human IFITM3 gene micro-molecule interfering RNA (Ribose Nucleic Acid), a human IFITM3 gene interfering nucleic acid construct as well as human IFITM3 gene interfering lentivirus and use of the three. The siRNA (micro-molecule interfering RNA), nucleic acid construct containing the siRNA or lentivirus provided by the invention can be used for specifically inhibiting the expression of the human IFITM3 gene, especially the lentivirus can be used for effectively infecting target cells, efficiently inhibiting the expression of the IFITM3 gene in the target cells, further inhibiting the growth of the tumor cells and promoting the apoptosis of tumor cells, and has important meaning in tumor treatment.

Description

technical field [0001] The invention relates to the field of biotechnology, and more specifically relates to the use of human IFITM3 gene and related medicines. Background technique [0002] RNA interference (RNAi) is a sequence-specific post-transcriptional gene silencing phenomenon mediated by double-stranded RNA. RNAi technology has high post-transcriptional silencing efficiency and specificity, and is expected to become a tool for gene therapy of tumor diseases (Izquierdo M.Short interfering RNAs as a tool for cancer genetherapy.Cancer Gene Ther.2005;12(3):217-27 .). Plasmid or viral vector can manipulate the expression of a 45-50nt hairpin RNA (short hairpin RNA, shRNA) in mammalian cells, shRNA will be automatically processed into small interfering RNA (small interfering RNA, siRNA) in the cell, This in turn triggers gene silencing or expression suppression. Lentiviral vectors have the advantages of large capacity for carrying gene fragments, high transfection effic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6886C12N15/113C12N15/63C12N15/867A61K48/00A61P35/00
CPCC12N15/1138C12N2310/14C12Q1/6886C12Q2600/136C12Q2600/158
Inventor 韩海雄孙琴顾雪锋杨敏金杨晟瞿红花曹跃琼
Owner SHANGHAI GENBASE BIOTECH CO LTD