Check patentability & draft patents in minutes with Patsnap Eureka AI!

Recombinant Escherichia coli and application thereof in preparation of anti-O157:H7 N-glycoprotein vaccine

A technology for recombining Escherichia coli and Escherichia coli is applied in the direction of recombinant DNA technology, resistance to vector-borne diseases, bacteria, etc., which can solve the problems of complicated steps, difficult operation, uneven glycoproteins, etc., and achieves simple production steps and short production cycle. , the effect of high yield

Active Publication Date: 2014-04-23
SHANDONG UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the randomness of the chemical activation of sugar chains, the glycoproteins produced by cross-linking are highly heterogeneous; at the same time, this method still has problems such as complicated steps and difficult operation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant Escherichia coli and application thereof in preparation of anti-O157:H7 N-glycoprotein vaccine
  • Recombinant Escherichia coli and application thereof in preparation of anti-O157:H7 N-glycoprotein vaccine
  • Recombinant Escherichia coli and application thereof in preparation of anti-O157:H7 N-glycoprotein vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Embodiment 1, knockout of Escherichia coli W3110waal gene

[0050] (1) Cloning of homologous fragments

[0051] The target gene was knocked out using the Red recombination system. Primers were designed according to the waal gene sequence published by Genbank:

[0052] pKD-waal F:

[0053] 5'-TTGGAAAAGTTATCATCATTATAAAGGTAAAACATGCTAACATCCTTTAAACTTCATTCATTGAAACCTTACACTCTGGTGTAGGCTGGAGCTGCTTC-3'

[0054] pKD-waal R:

[0055] 5'-GAGTTTTAACTCACTTCTTAAACTTGTTTATTCTTAATTAATTGTATTGTTACGATTATTAATGACGAGTAAGAGGACATGGGAATTAGCCATGGTCC-3'

[0056] The recombinant fragment with kanamycin resistance was amplified in vitro by PCR (polymerase chain reaction) with pKD4. The PCR reaction system is as follows: (primer concentration is 20 μmol / L)

[0057]

[0058] Template DNA 1μl, add water to make up to 50μl.

[0059] PCR reaction conditions: pre-denaturation at 97°C for 10 min, denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 90 s, extension at 72°...

Embodiment 2

[0075] Example 2, Construction of rfb gene cluster (GI: 3435170) expression vector

[0076] Primers were designed according to the genome sequence of Escherichia coli O157:H7 published by NCBI:

[0077] O157-1-F:

[0078] 5'-GTACCCGGGGATCCTCTAGAGTCGACGCATAAATTTTAATGCTTATCAAAACTATTAGC-3'

[0079] O157-1-R:

[0080] 5'-CATGGATGTCCGTATAAATGGACACACATAATAGCTTTAGTTTTATTAGTGA-3'

[0081] O157-2-F:

[0082] 5'-TCACTAATAAAACTAAAGCTATTATGTGTGTCCATTTATACGGACATCCATG-3'

[0083] O157-2-R:

[0084] 5'-TATGCGCGACAATTATAATGCACATCGTC-3'

[0085] O157-3-F:

[0086] 5'-TGACGATGTGCATTATAATTGTCGCGCATATTTTAACAATAAAACAAATGATGC-3'

[0087] O157-3-R:

[0088] 5'-GAATTTCTTCTCTCATCCGCCAAAACAGAAGCTTTGTTTACTCCTGTCAGGGGTTACC-3'

[0089] Using the O157:H7 genome as a template, using O157-1-F and O157-1-R, O157-2-F and O157-2-R, O157-3-F and O157-3-R as primers respectively, divided into three The rfb gene cluster was cloned by PCR. The PCR reaction system is as follows: (primer concentration is ...

Embodiment 3

[0097] Embodiment 3, recombinant plasmid p-pglB-malE M build

[0098] (1) Construction of pglB gene (PglB NCBI-GeneID: 905417) expression vector

[0099] Primers were designed according to the genome sequence of Campylobacter jejuni NCTC11168 published by NCBI:

[0100] pglB-F:

[0101] 5'-CACGCCATGGTCTTGAAAAAAGAGTATTTAAAAAACCC-3'

[0102] pglB-R:

[0103] 5'-ATTCCCGGGTCAATGATGATGATGATGATGAATTTTAAGTTTAAAAACTTTAG-3'

[0104] Using NCTC11168 genome as template, pglB gene was cloned by PCR. The PCR reaction system is as follows: (primer concentration is 20 μmol / L)

[0105]

[0106] Template DNA 1μl, add water to make up to 50μl.

[0107] PCR reaction conditions: pre-denaturation at 97°C for 10min, denaturation at 94°C for 30s, annealing at 50°C for 30s, extension at 72°C for 2min, extension at 72°C for 10min after 30 cycles, and storage at 4°C.

[0108] The cloned pglB fragment was digested with endonucleases NcoI and SmaI respectively, and the plasmid vector pBAD24 was ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a recombinant Escherichia coli, named recombinant Escherichia coli CBEB, which is obtained by co-transforming constructed recombinant plasmid p-pglB-malEM and p-rfb into Escherichia coli CLM24, and the genotype of the recombinant Escherichia coli is W3110 deltaWaal / p-pglB-malEM+p-rfb. The recombinant Escherichia coli disclosed by the invention is fermented to prepare an anti-O157:H7 N-glycoprotein vaccine, the preparation steps are simple, the production period is short, the yield is high and the production cost is low, so that the recombinant Escherichia coli can be applied to large-scale production of the anti-O157:H7 N-glycoprotein vaccine; moreover, the anti-O157:H7 N-glycoprotein vaccine produced by the method disclosed by the invention has a good immune effect, provides a new choice for immunotherapy of antibacterial infection and has good industrial development and application prospects.

Description

technical field [0001] The invention relates to a strain of recombinant Escherichia coli, its construction method and the application of the recombinant strain in the production of anti-Escherichia coli O157:H7N-glycoprotein vaccine. It belongs to the fields of biotechnology, genetic engineering and microbial fermentation. Background technique [0002] Enterohemorrhagic Escherichia coli O157:H7 often causes bloody diarrhea, anemia and renal failure in clinical infection, often endangering the lives of patients. Escherichia coli O157:H7 has been isolated in my country, indicating that there is also a potential risk of outbreaks of this disease in my country, and sufficient attention should be paid to it. my country has listed enterohemorrhagic Escherichia coli as one of the 12 pathogenic microorganisms that may have a significant impact on the health of the Chinese people in the 21st century, ranking second only to HIV. The use of antibiotic therapy can lead to the dissolut...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/70A61K39/108A61P31/04C12R1/19
CPCY02A50/30
Inventor 陈敏马中瑞张化杰商文静王鹏
Owner SHANDONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com