Pseudomonas fluorescens cb113 QS system comQ gene deletion mutant strain and its application
A technology of Pseudomonas fluorescens and mutant strains, applied in the field of microorganisms, to achieve a good effect of inhibiting fungi
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0020] 1. Cloning the comQ gene from the genomic DNA of the CB113 strain
[0021] Primers were designed for the conserved sequence of comQ in bacteria related to the CB113 strain, and the comQ gene sequence of the strain was obtained by PCR. The gene comQ was located and cloned from CB113 strain by comparing the genome sequences and analyzing its function. The full sequence of comQ is as follows:
[0022] 1atgaaggagattgtaagccaaaaaataatgaatcaggacttggaacgatatcttcagaat
[0023] 61tttattgagtctaaggatacgtttgagtttgccgatttggctcttcatcattatttagct
[0024] 121tttaacggtcaggaccaaaaagcaatcgaattgctagctgccggaattgaattgcttata
[0025] 181ctctcattcgatatttatgatgacttagaggatcaagataatggaagtgctgtctggatg
[0026] 241aagattgactcgtcaatcgctttaaatgcagttacagctctttacaccctaagtatacaa
[0027] 301gtgatgtgtcaagctagtcatgaaccagaatttacacaagagatattgaattttgcgtta
[0028] 361caatcaattcaaggccagcatgatgatattgtgaatgcgccgcaaactgaagaagcctgt
[0029] 421cttgaaatgatcaaaaataaatcaggagcgctaacggcattgccctgtgtaatgggagta
...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 