Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Pseudomonas fluorescens cb113 QS system comQ gene deletion mutant strain and its application

A technology of Pseudomonas fluorescens and mutant strains, applied in the field of microorganisms, to achieve a good effect of inhibiting fungi

Inactive Publication Date: 2016-01-06
JILIN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the quorum sensing mechanism produced by each Gram-negative bacteria is different, its regulatory proteins are highly homologous, and most of the Gram-negative bacteria currently studied have similar QS systems

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pseudomonas fluorescens cb113 QS system comQ gene deletion mutant strain and its application
  • Pseudomonas fluorescens cb113 QS system comQ gene deletion mutant strain and its application
  • Pseudomonas fluorescens cb113 QS system comQ gene deletion mutant strain and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0020] 1. Cloning the comQ gene from the genomic DNA of the CB113 strain

[0021] Primers were designed for the conserved sequence of comQ in bacteria related to the CB113 strain, and the comQ gene sequence of the strain was obtained by PCR. The gene comQ was located and cloned from CB113 strain by comparing the genome sequences and analyzing its function. The full sequence of comQ is as follows:

[0022] 1atgaaggagattgtaagccaaaaaataatgaatcaggacttggaacgatatcttcagaat

[0023] 61tttattgagtctaaggatacgtttgagtttgccgatttggctcttcatcattatttagct

[0024] 121tttaacggtcaggaccaaaaagcaatcgaattgctagctgccggaattgaattgcttata

[0025] 181ctctcattcgatatttatgatgacttagaggatcaagataatggaagtgctgtctggatg

[0026] 241aagattgactcgtcaatcgctttaaatgcagttacagctctttacaccctaagtatacaa

[0027] 301gtgatgtgtcaagctagtcatgaaccagaatttacacaagagatattgaattttgcgtta

[0028] 361caatcaattcaaggccagcatgatgatattgtgaatgcgccgcaaactgaagaagcctgt

[0029] 421cttgaaatgatcaaaaataaatcaggagcgctaacggcattgccctgtgtaatgggagta

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a pseudomonas fluorescens CB113 QS system comQ gene deletion mutant strain and application thereof, and belongs to the technical field of microorganisms. The pseudomonas fluorescens mutant strain M2 is obtained due to the deletion of comQ gene coding sequence 675bp in pseudomonas fluorescens CB113. Compared with the wild type strain, the pseudomonas fluorescens mutant strain M2 has an advantage in application that the inhibitory activity to pathogenic fungus consisting of exserohilum turcicum and cylindrocarpon destructans is obviously improved. The strain provided by the invention shows the characteristics of relatively high fungus inhibiting characteristics and brings a good way for inhibiting fungus for the prior art.

Description

technical field [0001] The invention relates to a strain of Pseudomonas fluorescens, in particular to a mutant strain of Pseudomonas fluorescens with comQ gene deletion, and belongs to the technical field of microorganisms. Background technique [0002] Bacterial quorum sensing (QS) is an important mechanism for bacteria to communicate with each other and coordinate group behavior according to the population density. Although the quorum sensing mechanism produced by each Gram-negative bacteria is different, its regulatory proteins are highly homologous, and most of the Gram-negative bacteria currently studied have similar QS systems. In Pseudomonas fluorescens, comX-comQ-comP-comA is the main signaling pathway in the QS system, regulating the formation of bacterial competent cells, the production of spores, the formation of biofilms and the production of antibiotics. The comX gene encodes a 55-amino acid comX pheromone precursor, and comQ is responsible for converting the i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21A01N63/00A01P3/00C12R1/39
Inventor 张祥辉王璐潘洪玉赵玉海王秀明
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com