Primers, method and kit for detecting inversion of first intron of hemophilia A clotting factor VIII gene
A blood coagulation factor and hemophilia technology, applied in the fields of life sciences and biology, can solve the problems of affecting the formation of FⅧ gene mRNA, lack of normal protein and severe hemophilia A, etc., saving manpower, simple and convenient operation, and improving amplification efficiency Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] A kit for in vitro diagnosis of the first intron of the coagulation factor VIII gene of hemophilia A, including: dNTP, 2*PCR buffer, MgCl 2 , Taq enzyme; multiple primers A liquid and B liquid mixed in a certain proportion; instructions for use.
[0051] Among them, MgCl 2 The final concentration of the reaction was 1.0mM, and the final concentration of the dNTP reaction was 3.0mM.
[0052] Solution A (tube I) includes: primers 9F (SEQ ID NO.1) q9R (SEQ ID NO.2), Intlh-2F (SEQ ID NO.3) for amplifying the Intlh-1 region of the FⅧ gene; its base sequence for:
[0053] SEQ ID NO.1: AGACTTTGGGGTTGTTGGGA
[0054] SEQ ID NO. 2: GCTCAAGCTAGGATGGCTCTGC
[0055] SEQ ID NO. 3: GGCAGGGATCTTGTTGGTAAA;
[0056] Solution B (tube II) includes: primers 9F (SEQ ID NO.1), Intlh-2F (SEQ ID NO.3), Intlh-2R (SEQ ID NO.4) for amplifying the Intlh-2 region of the FⅧ gene; The base sequence is:
[0057] SEQ ID NO.1: AGACTTTGGGGTTGTTGGGA
[0058] SEQ ID NO. 3: GGCAGGGATCTTGTTGGTAAA
...
Embodiment 2
[0064] Embodiment 2: the usage method of kit
[0065] 1) Sample DNA extraction (according to the instructions of Tiangen Blood / Cell / Tissue Gene DNA Extraction Kit): to extract DNA from human blood samples, the sample extraction method is as follows.
[0066] 1.1 Take 300uL of blood and add 900uL of red blood cell lysate, mix by inverting, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 10000rpm for 1 minute (if the maximum speed of the centrifuge is not allowed, centrifuge at 3000rpm for 5min), absorb the supernatant, leave the white blood cell pellet, add 200uL buffer GA, shake until thoroughly mixed. Add 20 μl proteinase K solution and mix well.
[0067] 1.2 Add 200 μl buffer GB, mix well by inverting, place at 70°C for 10 minutes, the solution should become clear, centrifuge briefly to remove water droplets on the inner wall of the tube cap.
[0068] 1.3 Add 200 μl of absolute ethanol, shake and mix well fo...
Embodiment 3
[0092] Because hemophilia A is a sex-linked recessive genetic disease, the family inheritance is very obvious. For example, if a woman has hemophilia A, then the boy born must be hemophilia A, and the girl may be a carrier or hemophilia A, determined by the father's situation. Now in order to prove the reliability of the method we developed, we collected 6ml of blood samples from a hemophilia family clinically. The test members include: mother (for hemophilia), father (normal), daughter (unknown: presumed to be a carrier). According to the method for embodiment 2, detect: the result is as follows figure 2 , From the first tube reaction (int1h-1), it was found that the father's blood sample was confirmed to be a normal band: the electrophoresis band was 1.9kb. The mother's blood sample was confirmed to have intron 1 inversion of the FVIII gene, with a band of 1.3kb; the daughter was a carrier: the electrophoresis band contained both 1.9kb and 1.3kb. From the results of tub...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap