Supercharge Your Innovation With Domain-Expert AI Agents!

Eukaryotic expression vector containing attenuated SV40 promoter/dihydrofolate reductase expression element, and construction method thereof

A technology of eukaryotic expression vector and dihydrofolic acid, applied in the field of genetic engineering vector, can solve the problem of time-consuming and labor-intensive, and achieve the effect of ensuring universality, easy recombination operation and moderate size

Inactive Publication Date: 2014-06-18
LANZHOU INST OF BIOLOGICAL PROD
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is an urgent need in the field for a CHO (DHFR - ) universal carrier for high-level expression of target genes in cells, suitable for rapid construction of multiple foreign genes co-expressing DHFR genes, convenient for rapid screening of high-expression clones in the later stage, to overcome the time-consuming and laborious shortcomings of screening clones in the past

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Eukaryotic expression vector containing attenuated SV40 promoter/dihydrofolate reductase expression element, and construction method thereof
  • Eukaryotic expression vector containing attenuated SV40 promoter/dihydrofolate reductase expression element, and construction method thereof
  • Eukaryotic expression vector containing attenuated SV40 promoter/dihydrofolate reductase expression element, and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0097] Embodiment 1, the construction of eukaryotic expression vector pCMV-WD

[0098] (1) Design a weakened SV40 promoter / DHFR expression element

[0099] According to the method reported by Zenke M, et al in EMBO J.1986 February; 5(2):387-397., the SV40 promoter was weakened: the natural SV40 promoter contains two repeated 72bp enhancers The sequence, namely: GGTGTGGAAAGTCCCCCAGGCTCCCCAGCAGGCAG AAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCA, the author deleted the first enhancer sequence, and at the same time mutated the sequence TGG at positions 5-7 in the second enhancer sequence to GTT, resulting in a weakened SV40 promoter of 346 nucleotides sequence.

[0100] According to the pSV2-dhfr vector purchased from ATCC (number: 67110), the 564-nucleotide DHFR coding gene sequence was determined.

[0101] Based on past work experience, the inventor designed a 43-nucleotide junction sequence located between the SV40 promoter and the DHFR gene, connecting the weakened SV40 promoter, th...

Embodiment 2

[0121] Example 2. Using pCMV-WD plasmid to express Plasmodium falciparum sporangia surface membrane protein Pfs25Pfs25 target gene and primer synthesis

[0122] In the previous work, based on the Pfs25 gene information published in GenBank (GenBank locus: X07802), the author selected the DNA sequence corresponding to amino acids 23 to 193 of the complete pfs25 protein as the target gene. In this study, primers were designed using the primer synthesis software Primer premier5.0.

[0123] Pfs25 upstream primer:

[0124] GCAA gatatc ACACCATG AAAG TAACAGTCGATACTGTGTGTAAGAGAGGCTTCCT

[0125] The underline is the EcoR V restriction site, and the sequence in italics corresponds to the signal peptide: GVKVLFALICIAVAEA;

[0126] Pfs25 downstream primers:

[0127] TGAT ctcgag TTAAGTACATATTGATGA

[0128] The underline is the Xho I restriction site.

[0129] The target gene and primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. PCR conditions: 95°C, 4min; 95°...

Embodiment 3

[0142] Example 3, using pCMV-WD plasmid to express human nerve growth factor β subunit (β-hNGF)

[0143] Synthesis of β-hNGF gene and primers

[0144] Primers were designed according to the β-hNGF gene sequence (Accession No.: NM_002506) published in GenBank, and the upstream and downstream primers were synthesized by Shanghai Sangon Co., Ltd. The sequence is as follows: hNGF primer: P(s): 5’AGG GATATCACACCATGTCCATGTTAT 3' (underlined is EcoR V restriction site), P(a): 5'TG GGATCC GGTCAGGCTCTTCTC 3' (the underline is the restriction site of BamH I)

[0145] pUC18-β-NGF is provided by the National Institute for the Control of Pharmaceutical and Biological Products, which contains the full-length fragment of β-hNGF encoding 241 amino acids (including N-terminal 18 amino acid signal peptide). Using pUC18-β-NGF as a template, primers P(s) and P(a) amplify human nerve growth factor β subunit (β-hNGF) gene. PCR conditions: 95°C, 4min; 95°C, 60 seconds, 55°C, 60 seconds, 72°C, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
wavelengthaaaaaaaaaa
Login to View More

Abstract

The invention provides a eukaryotic expression vector capable of selecting high expression clones conveniently and high efficiently. The eukaryotic expression vector is obtained via structure modification by taking pBudCE4.1 carrier as a basic carrier; peptide chain elongation factor gene promoter (P) on the basic carrier, and multiple cloning sites on the downstream of the peptide chain elongation factor gene promoter (P) are replaced by an expression element composed of attenuated SV40 promoter and dihydrofolate reductase gene on the downstream of the attenuated SV40 promoter; multiple cloning sites on the downstream of cytomegalovirus early promoter (P) of the basic carrier are replaced by new multiple cloning sites.

Description

technical field [0001] The invention relates to a genetic engineering carrier, in particular to a eukaryotic expression carrier, in particular to a eukaryotic expression carrier capable of efficiently screening high-expression clones. Background technique [0002] The CHO cell expression system is one of the eukaryotic expression systems widely used at present. Compared with other expression systems, its advantage is that it has a good function of protein post-translational modification, and the expressed target protein has molecular structure, physical and chemical properties and biological functions. The closest to natural protein molecules, the disadvantages are the long time required to obtain high-expression cell lines and the high cost of large-scale cell culture. Therefore, rapid screening and obtaining CHO cell lines expressing foreign genes at a high level are research hotspots in the fields of genetic engineering and biopharmaceuticals. [0003] The efficient expr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/79C12N15/66
Inventor 陈勇蒋琳陆俭雷清马亚茹李刚
Owner LANZHOU INST OF BIOLOGICAL PROD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More