Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of carrier and application thereof for constructing cyanobacteria without screening tag

A technology for screening tags and cyanobacteria, applied in the direction of using vectors to introduce foreign genetic material, bacteria, and microorganism-based methods, etc., can solve the problems that cannot meet the requirements of genetic modification work

Active Publication Date: 2016-04-13
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method of genetic modification depends on the number of available resistance screening tags, and cannot meet the requirements of multi-gene loci (more than 3) or even genome-wide genetic modification.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of carrier and application thereof for constructing cyanobacteria without screening tag
  • A kind of carrier and application thereof for constructing cyanobacteria without screening tag
  • A kind of carrier and application thereof for constructing cyanobacteria without screening tag

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Construct the vector pXT218a or pXT218b for expressing the FLP gene in cyanobacteria to obtain the mutant strain of cyanobacteria without screening tags:

[0046] In order to verify the feasibility of using the FLP / FRT system to construct mutant strains of cyanobacteria without screening tags, vectors pXT218b and pXT218a were constructed based on the shuttle vector pRL59EH. In both vectors, P petJ promoter and P tac The promoters were used to drive the expression of the FLP gene in two mutant strains of cyanobacteria (Synechocystis PCC6803 and Synechococcus PCC7942), respectively.

[0047] 1) Construction of plasmid pXT218a

[0048] Using PpetJ-F (CATCGGGGGCTGTGTTGGC) and PpetJ-R (GTGTTTTACATAATATACCAAATTGTGGCATATGTTTCTCCTTTCAAGGATAAAGT) as a primer pair, PCR amplification was performed using the Synechocystis sp. PCC6803 genome as a template (the reaction system is shown in Table 1; the reaction procedure is shown in Table 2); Flp-F(ACTTTATCCTTGAAAGGAGAACATATGCCACAA...

Embodiment 2

[0061]Construction of Cyanobacteria Mutant Strain Carrying Resistance Selection Tag Using Kanamycin Resistance Gene Fragment Containing FRT Flanks

[0062] In order to verify the feasibility of the FLP / FRT system for constructing cyanobacterial mutants without screening tags, based on the kanamycin resistance gene fragment containing FRT flanks, constructs were used to knock out the phaAB gene and the phaAB gene in Synechocystis sp. Knockout plasmids pXT206 and pXT212 of the NS1 gene in Synechococcus sp. PCC7942. These two plasmids respectively contain the upstream and downstream homologous DNA fragments on both sides of the phaAB site and the NS1 site, and the kanamycin resistance gene fragment between the upstream and downstream homologous DNA fragments (the two resistance gene fragments flanked by FRT sites). These two plasmids were introduced into Synechocystis sp. PCC6803 and Synechococcus p. The sex gene fragment (with FRT sites on both sides of the resistance gene fra...

Embodiment 3

[0079] The vector pXT218a or pXT218b is used to construct mutant strains of cyanobacteria without screening tags:

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to the field of cyanobacteria gene engineering, specifically to a vector for constructing a screening label-free cyanobacteria mutant strain, and a method for constructing the screening label-free cyanobacteria mutant strain, wherein the vector comprises promoters and gene elements of the vector.

Description

technical field [0001] The invention relates to the field of cyanobacteria genetic engineering, in particular to a carrier for constructing cyanobacteria without screening tags and its application. Background technique [0002] Cyanobacteria are widely distributed in various environments on the earth and are a class of prokaryotes capable of plant-type photosynthesis. In 1996, the Kazusa Research Institute of Japan completed the whole genome sequencing of the cyanobacteria Synechocystis PCC6803, which is the first photosynthetic organism to complete the whole genome sequencing; so far, about 40 kinds of cyanobacteria genomes have been sequenced. In addition, some cyanobacteria strains including Synechocystis PCC6803, Synechococcus PCC7942 and Anabaena PCC7120 have become photosynthetic strains because of their simple cell structure, easy culture, relatively rapid growth, and simple and convenient genetic manipulation. It is an important model organism for the study of circa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/74C12N1/21C12R1/01C12R1/865
Inventor 吕雪峰谈晓明梁飞燕
Owner QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com