Molecular marker for cabbage cytoplasm male sterile line restore gene and application thereof

A fertility restoration gene and male sterility technology, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of slow breeding process, time-consuming and laborious, long cycle, etc., to speed up the breeding process , the effect of improving the selection efficiency

Active Publication Date: 2014-08-13
NORTHWEST A & F UNIV
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For good materials carrying restorer genes, in order to transfer them to sterile lines, they must go through the process of hybridization, self-crossing, and at the same time use the sterile line test cross to determine their genotypes. The operation is time-consuming, laborious, and the cycle is long.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker for cabbage cytoplasm male sterile line restore gene and application thereof
  • Molecular marker for cabbage cytoplasm male sterile line restore gene and application thereof
  • Molecular marker for cabbage cytoplasm male sterile line restore gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: Discovery of InDels markers linked to Chinese cabbage CMS7311 fertility restorer gene BcRfp

[0037] (1) Construction of isolated groups

[0038] The Chinese cabbage male sterile restorer line 01S325 bred from 5 generations of self-crossing of 83-2 Chinese cabbage (see Xiangping, 1996, "Paddy Field Autumn Vegetable Combination Model", Vegetables, 01: 28) was used as the male parent to give male sterile The breeding line CMS7311 was pollinated, and all the obtained F1 plants were fertile. F 2 Among the 258 sown individuals, the field fertility survey showed that 186 were male fertile and 72 were male sterile single plants. The x2 test showed that the fertility segregation ratio was 3:1 (x 0 2 = 1.013,x 0.05 , 1 2 =3.841), indicating that the fertility restoration of the male sterile line is a dominant gene controlled by a single gene.

[0039] (2) DNA extraction and marker screening

[0040] (1) Extract the genomic DNA of the material to be tested with...

Embodiment 2

[0046] Example 2: Transformation and identification of SCAR labeled InDel42

[0047] (1) Transformation of SCAR markers

[0048] Since the PCR product marked InDel42 in the sterile material lacks 12 bp compared with the fertile material, it is difficult to effectively separate the two by 0.8% agarose gel electrophoresis, and the marker can only be distinguished by converting the marker into a SCAR42 marker. The sequences in the fertile plants are as follows (the underlined part is the sequence missing from the sterile material):

[0049] ATGGAAGAAGCCCTAAGAAAGT TCAACGAATCTACCTACTCCTTCATACCCGGTTACGAACCCGACCCGATTCCTCTAACGAGAATCTTTGCCAATGATGCAAACTCCCCGCAGGTTAACAACACACCGTCTTCAAAGGAGGCAATAGTGACCATCACCGGATCTGGCAGGACAAGGTACCGTGGCGTTCGCCGAAGGCCGTGGGGACGTTACGCGGCGGAGATACGTGATCCCACGTCGAAGGAGAGACGTTGGCTCGGAACGTTCGATACGGCGGAGCAAGCCGCTTGTGCTTACGACTGTGCAGCTCGTGAGTTTCGTGGATCTAAGGCTCGGACCAACTATACTTATC CTGTTACTAATCCTGTT GCCGAGCCTAGATTCTCTTTCTCCTCAAAGAAATCTATGAAGGCCGTTCGTTCTCCTATACCGTCACCTCT...

Embodiment 3

[0054] Example 3: Application of two markers InDel78 and SCAR42 in the assisted selection of the Chinese cabbage CMS7311 fertility restorer gene

[0055] (1) Using the CTAB method to extract the genomic DNA of the material to be tested, the specific method is the same as before;

[0056] (2) PCR reaction

[0057] (1) PCR reaction system: 25ul system, the contents of each component are: 20ng template DNA; 2.5ul10×buffer; 1.8mM MgCl 2 ; 0.25mmol / L dNTP; 1pmol / L Primer: 1.5U Taq DNA polymerase; ddH 2 O make up to 25ul, mix well, and centrifuge;

[0058] (2) PCR amplification program: pre-denaturation at 94°C / 5min, then 94°C / 60s, 56°C / 45s, 72°C / 1min, after 35 cycles, extension at 72°C for 5min;

[0059] (3) Electrophoresis: Take 6ul of PCR amplification product and mix with 2ul of 6×loading buffer, put it into 0.8% agarose gel, electrophoresis at 150V for 25min, observe and take pictures in gel imager after EB staining ;

[0060] (4) Result analysis:

[0061] When the target...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a molecular marker for cabbage cytoplasm male sterile line restore gene and an application thereof, the molecular marker tightly linked with the cabbage cytoplasm male sterile line gene is the InDe178 maker and restorer sequence SCAR 42 maker positioned at two sides of cabbage CMS 7311 fertility restore gene and tightly linked with the cabbage CMS 7311 fertility restore gene, the genetic distance between the molecular marker InDe178 / SCAR 42 and the fertility restore gene are 0.91cM and 0.92cM respectively, and the fertility restore gene is limited in a range of 337kb of cabbage A09 chromosome. Two molecular markers can be used for molecular marker auxiliary selection of cabbage CMS 7311 fertility restore gene, selection efficiency is increased, breeding process is accelerated; and the molecular markers establish a base for map-based cloning of fertility restore gene, reveal of cytoplasm male sterility and molecular mechanism of fertility restore gene.

Description

technical field [0001] The invention belongs to the field of agricultural plant molecular marker assisted breeding, and relates to a molecular marker closely linked with a Chinese cabbage cytoplasmic male sterility gene and its application. Background technique [0002] Chinese cabbage (Brassica campestris L. ssp. pekinensis (Lour.) Olsson) is one of the most important vegetable crops in the Brassicaceae Brassica species. It is native to China and is a staple vegetable in my country and even in the world. As early as the 1990s, the Vegetable and Flower Research Institute of the Shaanxi Academy of Agricultural Sciences used interspecific hybridization and backcrossing techniques to breed Brassica napus CMS into Chinese cabbage to breed CMS7311 (Zhang Lugang, Hao Dongfang, temperature-sensitive cytoplasmic male unequal in head cabbage. Studies on the fertility transformation of the breeding line CMS7311, Acta Bot, 2001, 43(11): 1123-1128), further research confirmed that this ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor 张鲁刚许小勇张玉
Owner NORTHWEST A & F UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap