Method for detecting nano-silver particle by using fluorescence method based on G-tetramer
A technology of nano-silver particles and tetramers, applied in fluorescence/phosphorescence, material excitation analysis, etc., can solve the problem of distinguishing or detecting the total amount of nano-silver particles, and achieve stable and accurate results, great application prospects, and improved efficiency. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] A kind of method based on the fluorescence method of G tetramer to detect nano-silver particle, comprises the steps:
[0028] (1) Prepare the sample solution to be tested: add 2.5 μL of 100 μM phosphoric acid and 5.7 μL of 88 mM hydrogen peroxide to the nano silver aqueous solution, and the total volume of the solution after adding is 250 μL, making H 3 PO 4 and H 2 o 2 The final concentrations were 1 μM and 2 mM respectively, and after mixing, react at room temperature for 30 min to obtain the sample solution to be detected;
[0029] (2) Configure multiple standard solutions: configure seven silver nitrate solutions with concentrations of 0.5, 1, 2, 4, 6, 8, and 10 μM respectively as seven standard solutions to draw a standard curve;
[0030] (3) Take eight 2 μL 100 μM single-stranded DNA (G-DNA) solutions containing G base repeat sequence, the G-DNA sequence is TGGGTAGGGCGGGTTGGGAAA, and add them to eight 248 μL 20mM Tris-Ac, 2mM EDTA, pH 8.0 solution, heated at 9...
Embodiment 2
[0035] A kind of method based on the fluorescence method of G tetramer to detect nano-silver particle, comprises the steps:
[0036] (1) Configure the sample solution to be tested: add 10 μL of 100 μM phosphoric acid and 20 μL of 100 mM hydrogen peroxide to the nano-silver aqueous solution, and the total volume of the solution after adding is 1 mL, making H 3 PO 4 and H 2 o 2 The final concentrations are 1μM and 2mM respectively, and after mixing, react at room temperature for 30min to obtain the sample solution to be detected;
[0037] (2) Configure multiple standard solutions: configure seven silver nitrate solutions with concentrations of 0.5, 1, 2, 4, 6, 8, and 10 μM respectively as seven standard solutions to draw a standard curve;
[0038](3) Take eight 8 μL 100 μM single-stranded DNA (G-DNA) solutions containing G base repeat sequence, the G-DNA sequence is TGGGTAGGGCGGGTTGGGAAA, and add them to eight 992 μL 20mM Tris-Ac, 2mM EDTA, pH 8.0 solution, heated at 90°C fo...
PUM
| Property | Measurement | Unit |
|---|---|---|
| particle diameter | aaaaa | aaaaa |
| wavelength | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 