Glutamine synthetase high-efficiency expression vector with dual expression cassettes

A technology of glutamine and expression vectors, which is applied in the field of biopharmaceutical genetic engineering expression, can solve problems such as unsuitable for uniform expression level, unsuitable for high-efficiency protein expression, and large differences in protein expression levels

Active Publication Date: 2017-03-08
BEIJING BIYANG BIOTECH
View PDF6 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The characteristic or disadvantage of this system is that the expression level of the second protein is much lower than that of the first protein
The disadvantage of the pIRES system is that the expression levels of the two proteins expressed are quite different, and it is not suitable for expressing two proteins with uniform levels. High protein expression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Glutamine synthetase high-efficiency expression vector with dual expression cassettes
  • Glutamine synthetase high-efficiency expression vector with dual expression cassettes
  • Glutamine synthetase high-efficiency expression vector with dual expression cassettes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0013] Example 1, p327.7 expression vector whole gene synthesis and functional elements

[0014] Entrusted Shanghai Jierui Bioengineering Co., Ltd. to synthesize the whole gene of p327.7 expression vector, 8066bp, and the schematic diagram of its vector structure is as follows figure 1 As shown, the sequence is shown in SEQ ID NO:1.

[0015] 1. The first expression cassette element

[0016] 1. CMV immediate enhancer (1-659bp), as shown in SEQ ID NO:2.

[0017] 2. CMV promoter (669-750bp), as shown in SEQ ID NO:3.

[0018] 3. T7 RNA polymerase promoter (1067-1085bp)

[0019] TAATACGACTCACTATAGG

[0020] 4. Multiple cloning site A (1091-1125): XhoI-EcoRI-MluI,

[0021] CTCGAGTCTTGATAGCACCTATTGAATTCACGCGT

[0022] 5. SV40 poly A signal 1 (1150-1353bp), as shown in SEQ ID NO:4.

[0023] 2. The second expression cassette element

[0024] 1. CMV immediate enhancer 2 (1664-2322bp), as shown in SEQ ID NO:5.

[0025] 2. CMV immediate early promoter 2 (2325-2405bp), as shown in...

Embodiment 2

[0043] Example 2, construction of expression vector for anti-Her2 / neu humanized antibody BY01

[0044] Entrusted Shanghai Jierui Bioengineering Co., Ltd. to synthesize the gene encoding the L chain of the anti-Her2 / neu humanized antibody, as shown in SEQ ID NO:13. Cloned into p327.7 expression vector after XhoI and EcoRI double digestion, named p327.7 / L:

[0045] The underlined parts are the restriction sites of XhoI and EcoRI respectively, and start and stop codons, respectively.

[0046] Also commissioned Shanghai Jierui Bioengineering Co., Ltd. to synthesize the gene encoding the H chain of the anti-Her2 / neu humanized antibody, as shown in SEQ ID NO:14. It was cloned into the p327.7 / L expression vector after XbaI- and SalI double digestion, and named as p327.7 / HER2 expression vector.

[0047] Wherein the underlined parts are respectively the enzyme cutting sites of XbaI and SalI, and start and stop codons

[0048] Example 2, Screening of Anti-Her2 / neu Humanized B...

Embodiment 3

[0050] Example 3, Expression and preliminary purification of humanized BY01 antibody

[0051] The BY01 cells highly expressing the humanized antibody were cultured in serum-free CD OptiCHO, and the culture supernatant was collected after a certain period of time. Equilibrate HiTrapMabSelectSuRe 1ml column (GE Healthcare LifeSciences product, Cat.No: 11-0034-93) with PBS solution of pH 7.4 to 10 bed volumes, flow rate is 0.5ml / min; culture supernatant is filtered and loaded with 0.45μm filter membrane , the flow rate is 0.5ml / min. Wash again for 5-10 bed volumes with PBS solution at pH 7.4 at a flow rate of 0.5 ml / min; elute with 100 mM citric acid buffer (pH 3.6) at a flow rate of 0.5 ml / min and collect the eluted peaks.

[0052] The expression level of the antibody in the supernatant was detected by ELISA and protein A-HPLC to be 600 mg / L.

[0053] Purified humanized antibody BY01 non-reducing SDS-PAGE electrophoresis and reducing SDS-PAGE electrophoresis see figure 2 and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to a glutamine synthetase expression vector which can be amplified and have two expression cassettes. The main components of the glutamine synthetase expression vector include the following six parts: a first expression cassette component, a second expression cassette component, an f1 replicon, a glutamine synthetase expression cassette component, an ampicillin beta lactamase hydrolysis expression cassette component and a ColE1 replicon, wherein a strong enhancer / promotor CMV (Cytomegalovirus) and an immediate early enhancer / promotor are adopted to the first expression cassette component and the second expression cassette component; a weak promotor / enhancer SV40 is adopted to the glutamine synthetase expression cassette component, so that the expression of glutamine synthetase is reduced, and the screening of high-expression cloning is facilitated; and expression protein coding genes are respectively cloned to the expression vector through a multiple cloning site A and a multiple cloning site B. The glutamine synthetase expression vector disclosed by the invention is suitable for simultaneously expressing 1-2 proteins efficiently in mammalian cells and especially suitable for expressing antibody proteins.

Description

[0001] Technical field: [0002] The invention relates to the gene engineering expression technology of biopharmaceuticals, in particular to the construction and application of a vector used for the development of high-expression cell lines. Background technique [0003] Born in the late 1970s, biopharmaceuticals have rapidly become an eye-catching field in the pharmaceutical industry because of their incomparable advantages. The main application fields of biotechnology are an important part of my country's improvement of people's livelihood. my country's huge population base and huge potential for growth in drug consumption provide my country's biotechnology development with broader market demand and development potential than foreign countries. The application of biopharmaceuticals is mainly in these fields: various tumors, autoimmune diseases (such as lupus erythematosus, asthma, multiple sclerosis, rheumatoid arthritis, etc.), diabetes, cardiovascular diseases and other fr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/85C12N15/52
Inventor胡品良白洁洪伟东邹敬宋凌云杨泽荣
OwnerBEIJING BIYANG BIOTECH