Nucleic acid synthesis method based on bidirectional isothermal extension

A synthetic method and isothermal technology, applied in DNA preparation, recombinant DNA technology, etc., can solve problems such as difficult high-throughput synthesis, wrong hybridization, and inability to splice

Active Publication Date: 2014-12-17
WUXI QINGLAN BIOLOGICAL SCI & TECH
View PDF3 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] All of the above methods require the use of overlapping oligonucleotides, so there is an endogenous problem of mishybridization, especially when there are repeated sequences or inverted repeats in the sequence, which can cause misligation or misligation. Mis-extension, or even complete splicing,

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid synthesis method based on bidirectional isothermal extension
  • Nucleic acid synthesis method based on bidirectional isothermal extension
  • Nucleic acid synthesis method based on bidirectional isothermal extension

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0082] Example 1: Synthesizing a 412-base sequence using inside-out mode, which is a part of the lambda exonuclease gene

[0083] The sequence is as follows (SEQ ID NO.1):

[0084] 5’-TCACAACGTGATAGCAAAACCCCGCTCCGGAAAGAAGTGGCCTGA

[0085] CATGAAAATGTCCTACTTCCACACCCTGCTTGCTGAGGTTTGC

[0086] ACCGGTGTGGCTCCGGAAGTTAACGCTAAAGCACTGGCC

[0087] TGGGGAAAACAGTACGAGAACGACGCCAGAACCCTGTTTG

[0088] AATTCACTTCCGGCGTGAATGTTACTGAATCCCCGATCATC

[0089] TATCGCGACGAAAGTATGCGTACCGCCTGCT

[0090] CTCCCGATGGTTTATGCAGCGACGGCAACGGCCTTGAACTGAA

[0091] ATGCCCGTTTACCTCCCGGGATTTCATGAAGTTCCGGCTCGGT

[0092] GGTTTCGAGGCCATAAAGTCAGCTTACATGGCCCAGGTGCAGTA

[0093] CAGCATGTGGGTGACGCGAAAAAATGCCTGGTACTTTGCCAAC-3'

[0094] The splicing process is as follows:

[0095] step 1

[0096] Segment the target sequence into 10 short DNA fragments (Table 2).

[0097] Table 2.

[0098]

[0099] step 2

[0100] These short DNA fragments L1-L5, R1-R5 were assembled into hairpins HL1-HL1, HR1-HR5 (Table 3), ...

Embodiment 2

[0119] Embodiment 2: the phospholipase gene of a section of 366 bases is synthesized with inside-out pattern

[0120] Its sequence is as follows (SEQ ID NO.12):

[0121] 5’AGCCTGCTGGAATTTGGGCGTATGATCAAGGAGGAGACGGGGAAAAACCCTCTTTCCTCCTACATCTCTTACGGATGCTACTGTGGCTGGGGGGGCCAAGGCGAGCCAAAGGACGACACCGACCGTTGCTGCTTTGTGCACGACTGCTGTTACGGAAAACTGTGGGGCTGCAGCCCAAAAACGGACATTTACTTCTACTTCCGTAAGAACGGGGCTATCGTCTGCGGACGTGGCACCTGGTGTGAGAAGCAGATTTGTGAGTGTGACAAGGCCGCCGCAATCTGCTTCCGTGAGAATCTGGCCACGTACAAAGAAGAATATCACTCTTACGGGAAGTCTGGTTGCACGGAGAAGTCACCGAAATGC3’

[0122] The starting double strand is a pJW vector digested by BglI, the pJW vector is a modified pUC19 vector, the BtsI and BglI sites on it have been removed through mutation treatment, and two BglI sites have been introduced into the multi-cloning site, After digestion with BglI, the two ends of this linear vector are the 3' hanging sticky ends of 'AGG' and 'GGT' respectively.

[0123] The designed oligonucleotides are listed in Table 4.

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention relates to a nucleic acid splicing method based on bidirectional isothermal extension. The method is as follows: an extension system is set up, the extension system comprises a starting double strand, a group of oligonucleotides which are mutually different and orderly spliced, mixed enzyme with connection, polymerization and restriction endonuclease activity, and a reaction buffer matching with the mixed enzyme; in the cooperation of multiple kinds of enzymes, and starting from the starting double strand, the oligonucleotides can be isothermally spliced for synthesis of a target DNA long chain. The nucleic acid splicing method has the characteristics of high success rate, simple design and simple operation, high automation, and the like, so that the nucleic acid splicing method has a potential low cost advantage, and has potential values of application in promotion of gene synthesis, and development of biological engineering, biomedical and bioinformatics fields.

Description

technical field [0001] The invention relates to a method in the field of nucleic acid synthesis, in particular to a nucleic acid splicing method for bidirectional isothermal extension. Background technique [0002] With the development of biotechnology and biomedicine, more and more attention has been paid to the design and modification of nucleic acid, especially DNA sequence. Traditional gene amplification, cloning, recombination and mutation methods can only obtain DNA sequences that exist in nature or are close to those in nature, while DNA chemical synthesis technology can synthesize user-specified oligonucleotide sequences, but due to the efficiency of chemical reactions And the problem of error rate, these oligonucleotide sequences are usually less than 120-200 bases in length. To obtain DNA sequences with a length of hundreds or even millions of bases, these oligonucleotides need to be spliced ​​together. The common splicing methods are: 1) ligase-based method (here...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/10
Inventor 林继伟戴俊彪
Owner WUXI QINGLAN BIOLOGICAL SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap