Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for extracting plasmodiophora brassicae DNA of cruciferae vegetables and application of method

A technology of cruciferous vegetables and an extraction method is applied in the field of isolating host-contaminated pathogenic bacteria DNA extraction, which can solve problems such as DNA molecular contamination of host plants, and achieve the effects of shortening the breeding cycle and speeding up the breeding process.

Inactive Publication Date: 2014-12-17
SHENYANG AGRI UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since clubroot fungus invades the roots of Brassicaceae plants, it mainly lives in the host root in the form of spores, zoospores, and sporangia. Currently, the commonly used methods for isolating clubroot DNA are contaminated by DNA molecules of the host plant. See related reports on extraction of clubroot bacteria using diatomaceous earth method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for extracting plasmodiophora brassicae DNA of cruciferae vegetables and application of method
  • Method for extracting plasmodiophora brassicae DNA of cruciferae vegetables and application of method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1: Chinese cabbage genome specific SSR marker detects CTAB method and diatomite method of the present invention extracts purity comparison

[0030] 1. Collection of clubroot pathogenic bacteria: 5 sources of clubroot pathogenic bacteria were collected from the diseased roots of the diseased plants in the main producing areas of cruciferous vegetables such as Yunnan, Liaoning, Shandong, etc., and the other material was from clubroot bacteria. Hosts include major cruciferous vegetables such as Chinese cabbage, cabbage, hybrids of black mustard and cauliflower, and radishes. The clubroot tissue sections were examined under a microscope, and dormant sporangia and swimming dormant spores were observed under the microscope, which was determined to be Plasmodium brassicae ( Plasmodiophora brassicae Wor.). The collected fresh mycorrhizae were washed, dried on the surface, and stored in a -20°C refrigerator.

[0031] Host identification: The identification of...

Embodiment 2

[0059] Comparison of the amplification results of the Genome Specific SSR Marker TCO1 of Plasmodium Plasmodium in the CTAB method and the diatomite method of the present invention.

[0060] 1. TC01 is based on the 18S rRNA (GenBank accession no. AF231027, 552bp) of the clubroot pathogen genome, which has the following nucleotide sequence:

[0061] 5’-gtggtcgaacttcattaaatttgggctcttagaagaagga gaagtcgtaacaaggtttccgtaggtgaacctgcagaagg atcattaaca cagtgggcgg ccctagcgct gcatcccaca

[0062] tcccaacccccaaccccatgtgaaccggtgacgtgcggcgta agctgcgtgtttcattttcgaaccatgctagccgaaacac aactgaagtt ccatacatac acatgttaca actcttagca

[0063] atggatatcttggttctcacaacgatgaagaacgcagcga actgcgatacgtagtgcgaattgcagaattcagtgaatca tcaaatcttt gaacgcaagt tgcgcttccg agataccctt

[0064] ggaagcatgcctctttgagtgtcggttcctgtttgtttgg gcgccccgcgcgcgcaagacaatgagctttgctgcggcat ggcttgaactagcgagacccgggaccgtgc gtgcattgttgagaacaccatcgagagaatgccggagcgg tccccgccga tctgcgcgca atcgaccacaa-3

[0065] Its specific amplification pr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for extracting plasmodiophora brassicae DNA of cruciferae vegetables and application of the method. A diatomite method is adopted to extract the DNA of a plasmodiophora brassicae sample of the cruciferae vegetables, the DNA of a plasmodiophora brassicae host is isolated, and a basis is laid for molecular studies of plasmodiophora brassicae. The method can be used for separating and detecting physiological strains of the plasmodiophora brassicae of the cruciferae vegetables, a specific molecular marker of the plasmodiophora brassicae is simultaneously used in a process of plant disease resistance identification, and the accuracy of specific disease resistance identification of the physiological strains can reach 100%. The method for extracting the plasmodiophora brassicae DNA of the cruciferae vegetables by using the diatomite method has good repeatability, high reliability and low detection cost and is time-saving and labor-saving.

Description

technical field [0001] The invention relates to a method for extracting DNA of plant pathogenic bacteria, in particular to a method for extracting DNA of pathogenic bacteria used for isolating host contamination. Background technique [0002] Clubroot of cruciferous vegetables is a worldwide disease caused by the infection of Brassica clubroot, and any susceptible variety of cruciferous vegetables will be infected by this pathogen. When the environmental conditions are favorable for the occurrence of the disease, the yield of cruciferous vegetables can be severely reduced, or even lost. [0003] There are many physiological races of clubroot fungus, which makes it difficult to control clubroot. Clubroot of Brassicaceae in China has relatively large occurrence area and wide distribution. Shen Xiangqun et al. (2009) initially identified 16 clubroot bacteria from Chinese cabbage collected from Liaoning, Shandong, Yunnan, Sichuan, Jilin and other regions using the Williams iden...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/04C12Q1/68C12N15/10C12R1/645
Inventor 沈向群杨阳沈昳潇姜晶朴钟云
Owner SHENYANG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com